Incidental Mutation 'R1942:Rbm45'
List |< first << previous [record 52 of 74] next >> last >|
ID216265
Institutional Source Beutler Lab
Gene Symbol Rbm45
Ensembl Gene ENSMUSG00000042369
Gene NameRNA binding motif protein 45
SynonymsG430095G15Rik, Drbp1, Drb1
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76369984-76383768 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 76375479 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046389]
Predicted Effect probably null
Transcript: ENSMUST00000046389
SMART Domains Protein: ENSMUSP00000040420
Gene: ENSMUSG00000042369

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RRM 27 102 2.08e-12 SMART
RRM 122 191 1.37e-12 SMART
RRM 249 320 2.27e-1 SMART
RRM 394 460 4.07e-6 SMART
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif (RRM)-type RNA-binding family of proteins. This protein exhibits preferential binding to poly(C) RNA. Initial cloning of this gene found that the rat ortholog was dynamically expressed in the developing rat brain. This protein has been localized to inclusion bodies in the brain and spinal cord of amyotrophic lateral sclerosis and Alzheimer's patients. A pseudogene has been identified on chromosome 8. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Rbm45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Rbm45 APN 2 76378707 missense probably damaging 1.00
IGL03335:Rbm45 APN 2 76376433 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0382:Rbm45 UTSW 2 76370211 missense possibly damaging 0.92
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1533:Rbm45 UTSW 2 76372159 critical splice donor site probably null
R2046:Rbm45 UTSW 2 76375398 missense probably benign
R2912:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2913:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2929:Rbm45 UTSW 2 76378419 missense probably benign 0.00
R3418:Rbm45 UTSW 2 76379018 missense probably damaging 1.00
R3886:Rbm45 UTSW 2 76375424 missense probably benign
R3887:Rbm45 UTSW 2 76375424 missense probably benign
R3888:Rbm45 UTSW 2 76375424 missense probably benign
R4488:Rbm45 UTSW 2 76376396 missense probably damaging 0.99
R5369:Rbm45 UTSW 2 76370250 missense probably damaging 1.00
R5990:Rbm45 UTSW 2 76370412 missense probably benign 0.36
R6569:Rbm45 UTSW 2 76379072 missense probably damaging 1.00
R6806:Rbm45 UTSW 2 76380460 missense probably benign 0.19
R7022:Rbm45 UTSW 2 76376394 missense probably damaging 1.00
R7832:Rbm45 UTSW 2 76376453 missense possibly damaging 0.80
R7915:Rbm45 UTSW 2 76376453 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GATGGCCACCATGTAAATTCTGC -3'
(R):5'- TCATACTTTTGGTGAATTGCGC -3'

Sequencing Primer
(F):5'- CACCATGTAAATTCTGCCTTGTATGG -3'
(R):5'- GCGCAAAAAAGCAGAATTC -3'
Posted On2014-08-01