Incidental Mutation 'R1942:Tmem245'
ID216269
Institutional Source Beutler Lab
Gene Symbol Tmem245
Ensembl Gene ENSMUSG00000055296
Gene Nametransmembrane protein 245
Synonyms
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56866923-56947437 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 56923511 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068792] [ENSMUST00000107609] [ENSMUST00000132816]
Predicted Effect probably benign
Transcript: ENSMUST00000068792
SMART Domains Protein: ENSMUSP00000067421
Gene: ENSMUSG00000055296

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
Pfam:UPF0118 589 838 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107609
SMART Domains Protein: ENSMUSP00000103234
Gene: ENSMUSG00000055296

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 212 231 N/A INTRINSIC
transmembrane domain 235 252 N/A INTRINSIC
low complexity region 309 330 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
Pfam:UPF0118 585 842 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125082
Predicted Effect probably benign
Transcript: ENSMUST00000132816
SMART Domains Protein: ENSMUSP00000117449
Gene: ENSMUSG00000055296

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:UPF0118 182 433 4.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155625
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Tmem245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02472:Tmem245 APN 4 56899119 missense probably damaging 1.00
IGL02668:Tmem245 APN 4 56925081 missense possibly damaging 0.86
IGL03093:Tmem245 APN 4 56886019 missense probably damaging 1.00
R0090:Tmem245 UTSW 4 56899410 missense probably benign
R0116:Tmem245 UTSW 4 56926213 missense probably benign 0.00
R0648:Tmem245 UTSW 4 56906270 missense probably benign 0.38
R0864:Tmem245 UTSW 4 56890837 missense probably damaging 1.00
R1102:Tmem245 UTSW 4 56903200 intron probably benign
R1548:Tmem245 UTSW 4 56906233 nonsense probably null
R1778:Tmem245 UTSW 4 56903968 missense probably damaging 1.00
R1840:Tmem245 UTSW 4 56903947 missense probably benign 0.03
R1969:Tmem245 UTSW 4 56937964 missense probably benign 0.01
R2341:Tmem245 UTSW 4 56937957 missense probably damaging 1.00
R2364:Tmem245 UTSW 4 56899391 missense probably damaging 0.96
R3848:Tmem245 UTSW 4 56926298 unclassified probably benign
R4591:Tmem245 UTSW 4 56910204 missense probably damaging 0.99
R4772:Tmem245 UTSW 4 56937989 splice site probably null
R4779:Tmem245 UTSW 4 56936468 missense possibly damaging 0.65
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R4860:Tmem245 UTSW 4 56899164 missense probably damaging 1.00
R5049:Tmem245 UTSW 4 56925057 missense probably benign 0.12
R5061:Tmem245 UTSW 4 56946945 missense possibly damaging 0.94
R5199:Tmem245 UTSW 4 56925149 missense probably benign 0.12
R5377:Tmem245 UTSW 4 56947084 missense probably damaging 0.99
R5547:Tmem245 UTSW 4 56910156 critical splice donor site probably null
R5846:Tmem245 UTSW 4 56903241 missense probably benign 0.00
R5851:Tmem245 UTSW 4 56916770 missense probably benign 0.02
R5991:Tmem245 UTSW 4 56916733 missense probably damaging 1.00
R6314:Tmem245 UTSW 4 56888592 missense possibly damaging 0.88
R6992:Tmem245 UTSW 4 56937940 missense probably benign 0.03
R7172:Tmem245 UTSW 4 56903946 missense possibly damaging 0.65
R7632:Tmem245 UTSW 4 56916787 missense probably benign 0.00
R7660:Tmem245 UTSW 4 56899170 missense possibly damaging 0.79
R7672:Tmem245 UTSW 4 56947069 missense probably benign
R7735:Tmem245 UTSW 4 56925155 missense probably benign 0.22
R7983:Tmem245 UTSW 4 56924973 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAAGACCCCATTGGAGCAG -3'
(R):5'- GGGATTCAGCTTCACAGAGG -3'

Sequencing Primer
(F):5'- TGGAGCAGCCCAATCATACCTTG -3'
(R):5'- ATGCTCAGCTGGTGGGGC -3'
Posted On2014-08-01