Mutagenetix > Incidental Mutation

Incidental Mutation 'R1942:Szt2'

216272

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

039960-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.591) question?

Stock #

R1942 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 118392620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 521 (T521K)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075406
AA Change: T521K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: T521K

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136737

Meta Mutation Damage Score

0.0849

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.7%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001L19Rik	A	C	13: 68,612,971	I171L	probably benign	Het
4930407I10Rik	A	T	15: 82,065,424	Y1174F	probably damaging	Het
Ahnak	A	G	19: 9,015,083	E4577G	probably damaging	Het
Anapc4	T	C	5: 52,846,714	V291A	probably benign	Het
Apba2	A	G	7: 64,695,470	E136G	possibly damaging	Het
Arhgap20	C	A	9: 51,831,698	Q279K	probably benign	Het
B3galnt1	A	T	3: 69,575,925	M1K	probably null	Het
C4bp	C	A	1: 130,656,067		probably benign	Het
Catsperg1	G	A	7: 29,206,807	T157I	possibly damaging	Het
Chrm1	T	A	19: 8,678,273	M114K	probably damaging	Het
Clasp1	A	G	1: 118,501,348	E329G	possibly damaging	Het
Clrn2	A	C	5: 45,453,995	Y62S	probably benign	Het
Col12a1	T	G	9: 79,635,466	D2339A	probably damaging	Het
Copa	T	A	1: 172,111,888	L564Q	probably damaging	Het
Cpeb2	C	A	5: 43,235,253		probably benign	Het
Dhx57	A	T	17: 80,265,144	M647K	probably damaging	Het
Diaph3	C	T	14: 87,141,120		probably benign	Het
Eomes	A	G	9: 118,484,648	D587G	probably benign	Het
Gm5142	T	A	14: 59,178,707	M1L	probably benign	Het
Gnl2	A	G	4: 125,030,164	I12V	probably benign	Het
Gprin1	C	T	13: 54,739,939	C174Y	probably benign	Het
Grin2b	A	T	6: 135,732,732	V1272E	possibly damaging	Het
Hdac9	A	G	12: 34,429,545	L227S	probably damaging	Het
Helz	T	A	11: 107,602,492	L247Q	probably benign	Het
Hs6st1	T	C	1: 36,068,722	V22A	probably benign	Het
Hspg2	C	A	4: 137,542,552	A2304E	possibly damaging	Het
Htr3a	T	C	9: 48,908,611	Y73C	probably damaging	Het
Il1rap	A	C	16: 26,722,455	E482A	probably damaging	Het
Itsn2	T	A	12: 4,639,670	L581*	probably null	Het
Msmb	A	G	14: 32,148,077	E2G	probably benign	Het
Muc19	T	C	15: 91,892,472		noncoding transcript	Het
Muc4	A	C	16: 32,750,642	L173F	probably damaging	Het
Muc5b	A	T	7: 141,857,684	S1456C	unknown	Het
Mylip	A	T	13: 45,406,696	I203F	probably damaging	Het
Nckap5	A	T	1: 126,024,302	D1504E	probably damaging	Het
Neil1	C	G	9: 57,146,607	R143P	probably benign	Het
Nlrp2	T	A	7: 5,322,448	T742S	probably damaging	Het
Nme8	A	G	13: 19,675,808	V214A	probably damaging	Het
Nsun7	C	T	5: 66,284,245	T419I	probably benign	Het
Nup210l	G	A	3: 90,151,237	E648K	probably benign	Het
Olfr1386	T	C	11: 49,470,154	M1T	probably null	Het
Olfr283	A	G	15: 98,378,564	L182P	probably damaging	Het
Olfr981	T	A	9: 40,022,735	L114H	probably damaging	Het
Olfr981	T	C	9: 40,022,752	Y120H	probably damaging	Het
Parp11	A	C	6: 127,470,700		probably null	Het
Pomgnt1	G	T	4: 116,155,275		probably null	Het
Ppp1r14c	T	C	10: 3,463,417	I150T	probably damaging	Het
Psd4	A	G	2: 24,405,793	E908G	probably damaging	Het
Psmd6	A	T	14: 14,116,442	V91E	probably damaging	Het
Ptk2b	A	T	14: 66,169,381	V634D	probably damaging	Het
Rapgef6	A	G	11: 54,657,263	I753V	possibly damaging	Het
Rbm45	G	A	2: 76,375,479		probably null	Het
Ric1	A	G	19: 29,601,016		probably benign	Het
Sh3rf2	A	G	18: 42,149,624	K416E	probably damaging	Het
Six5	C	T	7: 19,096,933	A495V	possibly damaging	Het
Slc27a6	T	A	18: 58,556,798	M112K	probably damaging	Het
Slc5a4a	T	C	10: 76,147,588	S20P	unknown	Het
Smg1	A	G	7: 118,158,103		probably benign	Het
Sntb2	G	A	8: 107,011,352	A511T	probably damaging	Het
Stk31	A	T	6: 49,439,127	N622I	probably damaging	Het
Sulf1	T	C	1: 12,848,173	F38S	probably damaging	Het
Terf1	G	T	1: 15,805,814	R46I	probably benign	Het
Tmem245	A	G	4: 56,923,511		probably benign	Het
Tmigd1	T	C	11: 76,914,079		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Umod	A	G	7: 119,476,932	Y204H	probably damaging	Het
Vcan	T	A	13: 89,703,424	Q1139L	probably benign	Het
Vmn1r85	T	A	7: 13,084,741	T159S	possibly damaging	Het
Vmn2r103	T	A	17: 19,812,300	S779T	probably benign	Het
Vmn2r27	C	T	6: 124,223,763	A412T	probably damaging	Het
Zc3h12d	A	C	10: 7,853,313	D147A	probably damaging	Het
Zfp800	A	T	6: 28,243,273	D564E	probably benign	Het
Zfp932	A	G	5: 110,006,987	E17G	probably damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGGCTAAAGCTGGTTTGG -3'
(R):5'- CGTTATTCGCCGTTTCTGGAAC -3'

Sequencing Primer
(F):5'- CTAAAGCTGGTTTGGGTGCCTC -3'
(R):5'- CGTTTCTGGAACACACTACAGAGG -3'

Posted On

2014-08-01