Incidental Mutation 'R1942:Szt2'
ID 216272
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 039960-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R1942 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 118249817 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 521 (T521K)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075406
AA Change: T521K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: T521K

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136737
Meta Mutation Damage Score 0.0849 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 81,949,625 (GRCm39) Y1174F probably damaging Het
Ahnak A G 19: 8,992,447 (GRCm39) E4577G probably damaging Het
Anapc4 T C 5: 53,004,056 (GRCm39) V291A probably benign Het
Apba2 A G 7: 64,345,218 (GRCm39) E136G possibly damaging Het
Arhgap20 C A 9: 51,742,998 (GRCm39) Q279K probably benign Het
B3galnt1 A T 3: 69,483,258 (GRCm39) M1K probably null Het
C4bp C A 1: 130,583,804 (GRCm39) probably benign Het
Catsperg1 G A 7: 28,906,232 (GRCm39) T157I possibly damaging Het
Cfap90 A C 13: 68,761,090 (GRCm39) I171L probably benign Het
Chrm1 T A 19: 8,655,637 (GRCm39) M114K probably damaging Het
Clasp1 A G 1: 118,429,078 (GRCm39) E329G possibly damaging Het
Clrn2 A C 5: 45,611,337 (GRCm39) Y62S probably benign Het
Col12a1 T G 9: 79,542,748 (GRCm39) D2339A probably damaging Het
Copa T A 1: 171,939,455 (GRCm39) L564Q probably damaging Het
Cpeb2 C A 5: 43,392,596 (GRCm39) probably benign Het
Dhx57 A T 17: 80,572,573 (GRCm39) M647K probably damaging Het
Diaph3 C T 14: 87,378,556 (GRCm39) probably benign Het
Eomes A G 9: 118,313,716 (GRCm39) D587G probably benign Het
Gm5142 T A 14: 59,416,156 (GRCm39) M1L probably benign Het
Gnl2 A G 4: 124,923,957 (GRCm39) I12V probably benign Het
Gprin1 C T 13: 54,887,752 (GRCm39) C174Y probably benign Het
Grin2b A T 6: 135,709,730 (GRCm39) V1272E possibly damaging Het
Hdac9 A G 12: 34,479,544 (GRCm39) L227S probably damaging Het
Helz T A 11: 107,493,318 (GRCm39) L247Q probably benign Het
Hs6st1 T C 1: 36,107,803 (GRCm39) V22A probably benign Het
Hspg2 C A 4: 137,269,863 (GRCm39) A2304E possibly damaging Het
Htr3a T C 9: 48,819,911 (GRCm39) Y73C probably damaging Het
Il1rap A C 16: 26,541,205 (GRCm39) E482A probably damaging Het
Itsn2 T A 12: 4,689,670 (GRCm39) L581* probably null Het
Msmb A G 14: 31,870,034 (GRCm39) E2G probably benign Het
Muc19 T C 15: 91,776,666 (GRCm39) noncoding transcript Het
Muc4 A C 16: 32,569,460 (GRCm39) L173F probably damaging Het
Muc5b A T 7: 141,411,421 (GRCm39) S1456C unknown Het
Mylip A T 13: 45,560,172 (GRCm39) I203F probably damaging Het
Nckap5 A T 1: 125,952,039 (GRCm39) D1504E probably damaging Het
Neil1 C G 9: 57,053,891 (GRCm39) R143P probably benign Het
Nlrp2 T A 7: 5,325,447 (GRCm39) T742S probably damaging Het
Nme8 A G 13: 19,859,978 (GRCm39) V214A probably damaging Het
Nsun7 C T 5: 66,441,588 (GRCm39) T419I probably benign Het
Nup210l G A 3: 90,058,544 (GRCm39) E648K probably benign Het
Or10g6 T A 9: 39,934,031 (GRCm39) L114H probably damaging Het
Or10g6 T C 9: 39,934,048 (GRCm39) Y120H probably damaging Het
Or2y1c T C 11: 49,360,981 (GRCm39) M1T probably null Het
Or8s2 A G 15: 98,276,445 (GRCm39) L182P probably damaging Het
Parp11 A C 6: 127,447,663 (GRCm39) probably null Het
Pomgnt1 G T 4: 116,012,472 (GRCm39) probably null Het
Ppp1r14c T C 10: 3,413,417 (GRCm39) I150T probably damaging Het
Psd4 A G 2: 24,295,805 (GRCm39) E908G probably damaging Het
Psmd6 A T 14: 14,116,442 (GRCm38) V91E probably damaging Het
Ptk2b A T 14: 66,406,830 (GRCm39) V634D probably damaging Het
Rapgef6 A G 11: 54,548,089 (GRCm39) I753V possibly damaging Het
Rbm45 G A 2: 76,205,823 (GRCm39) probably null Het
Ric1 A G 19: 29,578,416 (GRCm39) probably benign Het
Sh3rf2 A G 18: 42,282,689 (GRCm39) K416E probably damaging Het
Six5 C T 7: 18,830,858 (GRCm39) A495V possibly damaging Het
Slc27a6 T A 18: 58,689,870 (GRCm39) M112K probably damaging Het
Slc5a4a T C 10: 75,983,422 (GRCm39) S20P unknown Het
Smg1 A G 7: 117,757,326 (GRCm39) probably benign Het
Sntb2 G A 8: 107,737,984 (GRCm39) A511T probably damaging Het
Stk31 A T 6: 49,416,061 (GRCm39) N622I probably damaging Het
Sulf1 T C 1: 12,918,397 (GRCm39) F38S probably damaging Het
Terf1 G T 1: 15,876,038 (GRCm39) R46I probably benign Het
Tmem245 A G 4: 56,923,511 (GRCm39) probably benign Het
Tmigd1 T C 11: 76,804,905 (GRCm39) probably null Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Umod A G 7: 119,076,155 (GRCm39) Y204H probably damaging Het
Vcan T A 13: 89,851,543 (GRCm39) Q1139L probably benign Het
Vmn1r85 T A 7: 12,818,668 (GRCm39) T159S possibly damaging Het
Vmn2r103 T A 17: 20,032,562 (GRCm39) S779T probably benign Het
Vmn2r27 C T 6: 124,200,722 (GRCm39) A412T probably damaging Het
Zc3h12d A C 10: 7,729,077 (GRCm39) D147A probably damaging Het
Zfp800 A T 6: 28,243,272 (GRCm39) D564E probably benign Het
Zfp932 A G 5: 110,154,853 (GRCm39) E17G probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGCTAAAGCTGGTTTGG -3'
(R):5'- CGTTATTCGCCGTTTCTGGAAC -3'

Sequencing Primer
(F):5'- CTAAAGCTGGTTTGGGTGCCTC -3'
(R):5'- CGTTTCTGGAACACACTACAGAGG -3'
Posted On 2014-08-01