Incidental Mutation 'R1942:Anapc4'
ID216277
Institutional Source Beutler Lab
Gene Symbol Anapc4
Ensembl Gene ENSMUSG00000029176
Gene Nameanaphase promoting complex subunit 4
Synonyms2610306D21Rik, D5Ertd249e, APC4
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location52834012-52867797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52846714 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 291 (V291A)
Ref Sequence ENSEMBL: ENSMUSP00000031072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]
Predicted Effect probably benign
Transcript: ENSMUST00000031072
AA Change: V291A

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: V291A

DomainStartEndE-ValueType
Pfam:ANAPC4_WD40 10 57 9.1e-18 PFAM
low complexity region 137 147 N/A INTRINSIC
Pfam:ANAPC4 232 431 3.7e-61 PFAM
low complexity region 747 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142035
Predicted Effect probably benign
Transcript: ENSMUST00000144574
SMART Domains Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

DomainStartEndE-ValueType
Pfam:Apc4_WD40 10 57 4e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000150682
AA Change: V112A
Predicted Effect probably benign
Transcript: ENSMUST00000198207
Meta Mutation Damage Score 0.0918 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Anapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Anapc4 APN 5 52857211 missense probably damaging 0.98
IGL01066:Anapc4 APN 5 52857209 missense probably benign 0.08
IGL01109:Anapc4 APN 5 52848628 missense probably damaging 1.00
IGL01657:Anapc4 APN 5 52864626 nonsense probably null
IGL02692:Anapc4 APN 5 52864529 missense probably damaging 0.98
IGL02734:Anapc4 APN 5 52861291 missense probably benign 0.04
IGL03089:Anapc4 APN 5 52866398 missense probably benign 0.32
IGL03096:Anapc4 APN 5 52865929 missense possibly damaging 0.57
FR4304:Anapc4 UTSW 5 52864526 missense probably damaging 1.00
IGL03048:Anapc4 UTSW 5 52839733 missense probably benign 0.00
R0331:Anapc4 UTSW 5 52855642 splice site probably benign
R0511:Anapc4 UTSW 5 52842017 unclassified probably benign
R0624:Anapc4 UTSW 5 52845419 splice site probably benign
R0919:Anapc4 UTSW 5 52855637 missense probably benign 0.18
R1935:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1936:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1953:Anapc4 UTSW 5 52839688 missense probably damaging 1.00
R1954:Anapc4 UTSW 5 52846625 intron probably benign
R2341:Anapc4 UTSW 5 52841937 unclassified probably benign
R3696:Anapc4 UTSW 5 52862009 missense probably null 0.01
R4506:Anapc4 UTSW 5 52835730 missense possibly damaging 0.79
R4596:Anapc4 UTSW 5 52841718 missense probably benign 0.00
R5234:Anapc4 UTSW 5 52848776 missense probably damaging 1.00
R5256:Anapc4 UTSW 5 52863594 missense probably benign
R5310:Anapc4 UTSW 5 52859159 missense probably benign 0.00
R5401:Anapc4 UTSW 5 52863649 missense probably benign 0.01
R5409:Anapc4 UTSW 5 52848599 missense probably damaging 0.98
R5525:Anapc4 UTSW 5 52856809 missense probably damaging 1.00
R5575:Anapc4 UTSW 5 52855871 missense probably damaging 1.00
R5604:Anapc4 UTSW 5 52841734 nonsense probably null
R5695:Anapc4 UTSW 5 52862239 missense probably benign 0.00
R5955:Anapc4 UTSW 5 52865946 missense probably benign 0.01
R5974:Anapc4 UTSW 5 52845400 missense probably damaging 1.00
R6458:Anapc4 UTSW 5 52864553 missense possibly damaging 0.80
R6537:Anapc4 UTSW 5 52843556 missense probably damaging 0.98
R6633:Anapc4 UTSW 5 52865946 missense possibly damaging 0.85
R6860:Anapc4 UTSW 5 52848828 missense probably damaging 1.00
R6965:Anapc4 UTSW 5 52835751 missense possibly damaging 0.89
R7067:Anapc4 UTSW 5 52862235 missense probably benign
R7327:Anapc4 UTSW 5 52845330 missense probably damaging 0.99
R7442:Anapc4 UTSW 5 52857201 missense probably benign 0.08
R7837:Anapc4 UTSW 5 52859208 critical splice donor site probably null
R7920:Anapc4 UTSW 5 52859208 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTTTATTGAGTTAGAAGAGTAGTTG -3'
(R):5'- AAACTAAGGTTGTACTGAACCATCT -3'

Sequencing Primer
(F):5'- GAGTAGTTGGAAGTAAATTCTGCC -3'
(R):5'- ATGAATTACTCAGGCAGCTCTCTGG -3'
Posted On2014-08-01