Mutagenetix > Incidental Mutation

Incidental Mutation 'R1942:Grin2b'

216285

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

039960-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1942 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135732732 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1272 (V1272E)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053880
AA Change: V1272E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: V1272E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111905
AA Change: V1272E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: V1272E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Meta Mutation Damage Score

0.0823

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.7%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001L19Rik	A	C	13: 68,612,971	I171L	probably benign	Het
4930407I10Rik	A	T	15: 82,065,424	Y1174F	probably damaging	Het
Ahnak	A	G	19: 9,015,083	E4577G	probably damaging	Het
Anapc4	T	C	5: 52,846,714	V291A	probably benign	Het
Apba2	A	G	7: 64,695,470	E136G	possibly damaging	Het
Arhgap20	C	A	9: 51,831,698	Q279K	probably benign	Het
B3galnt1	A	T	3: 69,575,925	M1K	probably null	Het
C4bp	C	A	1: 130,656,067		probably benign	Het
Catsperg1	G	A	7: 29,206,807	T157I	possibly damaging	Het
Chrm1	T	A	19: 8,678,273	M114K	probably damaging	Het
Clasp1	A	G	1: 118,501,348	E329G	possibly damaging	Het
Clrn2	A	C	5: 45,453,995	Y62S	probably benign	Het
Col12a1	T	G	9: 79,635,466	D2339A	probably damaging	Het
Copa	T	A	1: 172,111,888	L564Q	probably damaging	Het
Cpeb2	C	A	5: 43,235,253		probably benign	Het
Dhx57	A	T	17: 80,265,144	M647K	probably damaging	Het
Diaph3	C	T	14: 87,141,120		probably benign	Het
Eomes	A	G	9: 118,484,648	D587G	probably benign	Het
Gm5142	T	A	14: 59,178,707	M1L	probably benign	Het
Gnl2	A	G	4: 125,030,164	I12V	probably benign	Het
Gprin1	C	T	13: 54,739,939	C174Y	probably benign	Het
Hdac9	A	G	12: 34,429,545	L227S	probably damaging	Het
Helz	T	A	11: 107,602,492	L247Q	probably benign	Het
Hs6st1	T	C	1: 36,068,722	V22A	probably benign	Het
Hspg2	C	A	4: 137,542,552	A2304E	possibly damaging	Het
Htr3a	T	C	9: 48,908,611	Y73C	probably damaging	Het
Il1rap	A	C	16: 26,722,455	E482A	probably damaging	Het
Itsn2	T	A	12: 4,639,670	L581*	probably null	Het
Msmb	A	G	14: 32,148,077	E2G	probably benign	Het
Muc19	T	C	15: 91,892,472		noncoding transcript	Het
Muc4	A	C	16: 32,750,642	L173F	probably damaging	Het
Muc5b	A	T	7: 141,857,684	S1456C	unknown	Het
Mylip	A	T	13: 45,406,696	I203F	probably damaging	Het
Nckap5	A	T	1: 126,024,302	D1504E	probably damaging	Het
Neil1	C	G	9: 57,146,607	R143P	probably benign	Het
Nlrp2	T	A	7: 5,322,448	T742S	probably damaging	Het
Nme8	A	G	13: 19,675,808	V214A	probably damaging	Het
Nsun7	C	T	5: 66,284,245	T419I	probably benign	Het
Nup210l	G	A	3: 90,151,237	E648K	probably benign	Het
Olfr1386	T	C	11: 49,470,154	M1T	probably null	Het
Olfr283	A	G	15: 98,378,564	L182P	probably damaging	Het
Olfr981	T	A	9: 40,022,735	L114H	probably damaging	Het
Olfr981	T	C	9: 40,022,752	Y120H	probably damaging	Het
Parp11	A	C	6: 127,470,700		probably null	Het
Pomgnt1	G	T	4: 116,155,275		probably null	Het
Ppp1r14c	T	C	10: 3,463,417	I150T	probably damaging	Het
Psd4	A	G	2: 24,405,793	E908G	probably damaging	Het
Psmd6	A	T	14: 14,116,442	V91E	probably damaging	Het
Ptk2b	A	T	14: 66,169,381	V634D	probably damaging	Het
Rapgef6	A	G	11: 54,657,263	I753V	possibly damaging	Het
Rbm45	G	A	2: 76,375,479		probably null	Het
Ric1	A	G	19: 29,601,016		probably benign	Het
Sh3rf2	A	G	18: 42,149,624	K416E	probably damaging	Het
Six5	C	T	7: 19,096,933	A495V	possibly damaging	Het
Slc27a6	T	A	18: 58,556,798	M112K	probably damaging	Het
Slc5a4a	T	C	10: 76,147,588	S20P	unknown	Het
Smg1	A	G	7: 118,158,103		probably benign	Het
Sntb2	G	A	8: 107,011,352	A511T	probably damaging	Het
Stk31	A	T	6: 49,439,127	N622I	probably damaging	Het
Sulf1	T	C	1: 12,848,173	F38S	probably damaging	Het
Szt2	G	T	4: 118,392,620	T521K	probably benign	Het
Terf1	G	T	1: 15,805,814	R46I	probably benign	Het
Tmem245	A	G	4: 56,923,511		probably benign	Het
Tmigd1	T	C	11: 76,914,079		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Umod	A	G	7: 119,476,932	Y204H	probably damaging	Het
Vcan	T	A	13: 89,703,424	Q1139L	probably benign	Het
Vmn1r85	T	A	7: 13,084,741	T159S	possibly damaging	Het
Vmn2r103	T	A	17: 19,812,300	S779T	probably benign	Het
Vmn2r27	C	T	6: 124,223,763	A412T	probably damaging	Het
Zc3h12d	A	C	10: 7,853,313	D147A	probably damaging	Het
Zfp800	A	T	6: 28,243,273	D564E	probably benign	Het
Zfp932	A	G	5: 110,006,987	E17G	probably damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCCATGAATCGGCCCTTGTC -3'
(R):5'- GAACCTGACCAATGTGGATTG -3'

Sequencing Primer
(F):5'- GAATCGGCCCTTGTCTTTCAGG -3'
(R):5'- ATAGGTCTGGGGGCAACTTC -3'

Posted On

2014-08-01