Incidental Mutation 'R1942:Arhgap20'
ID216299
Institutional Source Beutler Lab
Gene Symbol Arhgap20
Ensembl Gene ENSMUSG00000053199
Gene NameRho GTPase activating protein 20
Synonyms6530403F17Rik, A530023E23Rik
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location51765337-51853856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51831698 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 279 (Q279K)
Ref Sequence ENSEMBL: ENSMUSP00000065633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065496] [ENSMUST00000130405]
Predicted Effect probably benign
Transcript: ENSMUST00000065496
AA Change: Q279K

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065633
Gene: ENSMUSG00000053199
AA Change: Q279K

DomainStartEndE-ValueType
PH 86 187 3.31e-5 SMART
Pfam:RA 194 283 3.6e-15 PFAM
RhoGAP 374 548 1.27e-41 SMART
internal_repeat_1 655 779 9.97e-15 PROSPERO
internal_repeat_1 797 922 9.97e-15 PROSPERO
low complexity region 935 962 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126567
Predicted Effect probably benign
Transcript: ENSMUST00000130405
AA Change: Q243K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120124
Gene: ENSMUSG00000053199
AA Change: Q243K

DomainStartEndE-ValueType
PH 50 151 3.31e-5 SMART
Pfam:RA 158 247 3.3e-14 PFAM
RhoGAP 338 512 1.27e-41 SMART
internal_repeat_1 619 743 7.07e-15 PROSPERO
internal_repeat_1 761 886 7.07e-15 PROSPERO
low complexity region 899 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152203
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of RHO-type GTPases, transducing a signal from RAP1 to RHO and impacting neurite outgrowth. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Arhgap20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Arhgap20 APN 9 51849413 missense probably benign 0.00
IGL01542:Arhgap20 APN 9 51838887 missense probably benign
IGL01815:Arhgap20 APN 9 51846168 missense probably damaging 1.00
IGL01975:Arhgap20 APN 9 51849797 nonsense probably null
IGL02041:Arhgap20 APN 9 51846190 missense possibly damaging 0.92
IGL02557:Arhgap20 APN 9 51821273 missense probably damaging 1.00
IGL02602:Arhgap20 APN 9 51825843 missense probably damaging 1.00
IGL02741:Arhgap20 APN 9 51848645 missense probably benign 0.17
IGL02792:Arhgap20 APN 9 51849918 missense possibly damaging 0.89
IGL03166:Arhgap20 APN 9 51849777 missense possibly damaging 0.63
P0047:Arhgap20 UTSW 9 51849236 missense probably damaging 1.00
R0115:Arhgap20 UTSW 9 51838972 missense probably damaging 1.00
R0121:Arhgap20 UTSW 9 51838951 missense possibly damaging 0.91
R0539:Arhgap20 UTSW 9 51850155 missense probably benign 0.01
R0541:Arhgap20 UTSW 9 51849663 missense probably damaging 1.00
R0551:Arhgap20 UTSW 9 51825825 splice site probably benign
R0570:Arhgap20 UTSW 9 51840451 missense possibly damaging 0.56
R0630:Arhgap20 UTSW 9 51849384 missense probably damaging 0.98
R0931:Arhgap20 UTSW 9 51816741 missense probably benign 0.30
R0992:Arhgap20 UTSW 9 51816786 missense probably damaging 0.96
R1052:Arhgap20 UTSW 9 51846270 missense probably damaging 0.98
R1779:Arhgap20 UTSW 9 51849915 missense probably benign
R1839:Arhgap20 UTSW 9 51849326 missense probably damaging 0.99
R2292:Arhgap20 UTSW 9 51849443 missense possibly damaging 0.63
R3896:Arhgap20 UTSW 9 51816837 missense probably damaging 0.96
R4109:Arhgap20 UTSW 9 51816685 missense possibly damaging 0.60
R4166:Arhgap20 UTSW 9 51826835 critical splice acceptor site probably null
R4631:Arhgap20 UTSW 9 51840353 intron probably benign
R4692:Arhgap20 UTSW 9 51785788 missense probably damaging 1.00
R5273:Arhgap20 UTSW 9 51848616 missense probably damaging 1.00
R5505:Arhgap20 UTSW 9 51838948 missense probably damaging 0.98
R5743:Arhgap20 UTSW 9 51816727 missense probably benign 0.17
R5847:Arhgap20 UTSW 9 51824976 intron probably benign
R6006:Arhgap20 UTSW 9 51850126 missense probably benign
R6112:Arhgap20 UTSW 9 51829384 missense probably damaging 1.00
R6355:Arhgap20 UTSW 9 51843720 missense probably damaging 1.00
R6576:Arhgap20 UTSW 9 51849278 missense probably benign 0.03
R6801:Arhgap20 UTSW 9 51848592 missense probably damaging 1.00
R7130:Arhgap20 UTSW 9 51849747 missense probably damaging 0.98
R7318:Arhgap20 UTSW 9 51840502 missense probably benign
R7347:Arhgap20 UTSW 9 51849035 missense probably benign 0.07
R7500:Arhgap20 UTSW 9 51840502 missense probably benign
R7598:Arhgap20 UTSW 9 51849790 missense possibly damaging 0.95
R7677:Arhgap20 UTSW 9 51840398 missense probably damaging 0.97
R7725:Arhgap20 UTSW 9 51831750 missense possibly damaging 0.80
Z1177:Arhgap20 UTSW 9 51824924 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTTTATCCCAGATGGCCCAG -3'
(R):5'- CAGGTTCATCTGGGTGGAAG -3'

Sequencing Primer
(F):5'- ATGGCCCAGGTGTAAGTCAC -3'
(R):5'- CCGGGAATGCGAGCTTTTG -3'
Posted On2014-08-01