Incidental Mutation 'R1942:Neil1'
ID216300
Institutional Source Beutler Lab
Gene Symbol Neil1
Ensembl Gene ENSMUSG00000032298
Gene Namenei endonuclease VIII-like 1 (E. coli)
Synonyms2810450N13Rik
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57142800-57148305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 57146607 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 143 (R143P)
Ref Sequence ENSEMBL: ENSMUSP00000139917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000034842] [ENSMUST00000160147] [ENSMUST00000161182] [ENSMUST00000186410] [ENSMUST00000190245]
Predicted Effect probably benign
Transcript: ENSMUST00000034836
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034842
AA Change: R143P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034842
Gene: ENSMUSG00000032298
AA Change: R143P

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159711
Predicted Effect probably benign
Transcript: ENSMUST00000160147
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160280
Predicted Effect probably benign
Transcript: ENSMUST00000161182
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162634
Predicted Effect probably benign
Transcript: ENSMUST00000186410
AA Change: R143P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141048
Gene: ENSMUSG00000032298
AA Change: R143P

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190245
AA Change: R143P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139917
Gene: ENSMUSG00000032298
AA Change: R143P

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nei endonuclease VIII-like gene family which encodes DNA glycosylases. The encoded enzyme participates in the DNA repair pathway by initiating base excision repair by removing damaged bases, primarily oxidized pyrimidines. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice develop severe obesity, dyslipidemia, fatty liver disease and tend to show hyperinsulinemia and increased mtDNA damage and deletions. Sporadic phenotypes include reduced subcutaneous fat, skin ulcers, joint inflammation, infertility,and tumors. Male heterozygotes become obese. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Neil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Neil1 APN 9 57143977 critical splice donor site probably null
IGL02587:Neil1 APN 9 57144979 missense probably damaging 1.00
IGL03192:Neil1 APN 9 57143535 missense probably benign
R0138:Neil1 UTSW 9 57143746 splice site probably benign
R0348:Neil1 UTSW 9 57146781 unclassified probably null
R0356:Neil1 UTSW 9 57146896 missense possibly damaging 0.57
R1280:Neil1 UTSW 9 57146901 missense probably damaging 1.00
R1835:Neil1 UTSW 9 57146604 missense probably damaging 1.00
R1853:Neil1 UTSW 9 57144715 missense probably damaging 0.98
R2272:Neil1 UTSW 9 57146785 missense probably damaging 1.00
R3116:Neil1 UTSW 9 57146663 missense probably benign
R3608:Neil1 UTSW 9 57144201 missense probably damaging 1.00
R3713:Neil1 UTSW 9 57146970 missense probably damaging 1.00
R4883:Neil1 UTSW 9 57146922 missense probably damaging 1.00
R5744:Neil1 UTSW 9 57144201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTGCAAGCTTGTTTCTTAAG -3'
(R):5'- TCAGAAGCCACTGTCCCTTG -3'

Sequencing Primer
(F):5'- CTTAAGTACTACAAAAGCCTGATGC -3'
(R):5'- GATGTCAGGATCCTTCCAGCTG -3'
Posted On2014-08-01