Incidental Mutation 'R1942:Vcan'
List |< first << previous [record 68 of 74] next >> last >|
ID216320
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89703424 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1139 (Q1139L)
Ref Sequence ENSEMBL: ENSMUSP00000105171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
AA Change: Q1139L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614
AA Change: Q1139L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109546
AA Change: Q1139L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: Q1139L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
R6994:Vcan UTSW 13 89693407 missense possibly damaging 0.94
R6997:Vcan UTSW 13 89690618 missense probably damaging 0.98
R7029:Vcan UTSW 13 89690241 missense probably damaging 1.00
R7066:Vcan UTSW 13 89705686 missense probably damaging 1.00
R7156:Vcan UTSW 13 89689110 missense possibly damaging 0.95
R7171:Vcan UTSW 13 89725591 missense probably damaging 1.00
R7176:Vcan UTSW 13 89688936 missense probably benign 0.01
R7229:Vcan UTSW 13 89705270 missense possibly damaging 0.87
R7250:Vcan UTSW 13 89721686 missense probably damaging 1.00
R7250:Vcan UTSW 13 89731457 critical splice donor site probably null
R7262:Vcan UTSW 13 89705161 missense possibly damaging 0.62
R7289:Vcan UTSW 13 89692733 nonsense probably null
R7299:Vcan UTSW 13 89705266 missense probably benign
R7301:Vcan UTSW 13 89705266 missense probably benign
R7425:Vcan UTSW 13 89689832 missense probably damaging 0.99
R7514:Vcan UTSW 13 89704118 missense probably damaging 0.97
R7579:Vcan UTSW 13 89692458 missense probably damaging 1.00
R7618:Vcan UTSW 13 89692223 missense probably damaging 0.99
R7655:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7656:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7676:Vcan UTSW 13 89691789 missense probably damaging 1.00
R7719:Vcan UTSW 13 89704619 missense probably damaging 0.98
R7753:Vcan UTSW 13 89689323 missense probably damaging 1.00
R7762:Vcan UTSW 13 89692937 missense probably damaging 1.00
R7778:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7824:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7995:Vcan UTSW 13 89691858 missense probably benign
R7998:Vcan UTSW 13 89704327 missense probably damaging 1.00
R8033:Vcan UTSW 13 89704360 missense probably benign 0.04
R8061:Vcan UTSW 13 89657290 missense probably benign 0.45
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Z1176:Vcan UTSW 13 89692571 missense probably benign 0.10
Z1177:Vcan UTSW 13 89703524 missense probably benign 0.00
Z1177:Vcan UTSW 13 89703788 nonsense probably null
Z1177:Vcan UTSW 13 89704073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAAAGACACGTTGTTCCTC -3'
(R):5'- GGCACATCTTATCCACCTGGTG -3'

Sequencing Primer
(F):5'- AGACACGTTGTTCCTCAGTGAATG -3'
(R):5'- TCTTATCCACCTGGTGCAATAACAG -3'
Posted On2014-08-01