Incidental Mutation 'R1942:Ptk2b'
ID216324
Institutional Source Beutler Lab
Gene Symbol Ptk2b
Ensembl Gene ENSMUSG00000059456
Gene NamePTK2 protein tyrosine kinase 2 beta
SynonymsCAKbeta, cellular adhesion kinase beta, E430023O05Rik, proline-rich tyrosine kinase 2, Raftk, related adhesion focal tyrosine kinase, PYK2, calcium-dependent tyrosine kinase
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R1942 (G1)
Quality Score152
Status Validated
Chromosome14
Chromosomal Location66153257-66281052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66169381 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 634 (V634D)
Ref Sequence ENSEMBL: ENSMUSP00000137008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730]
Predicted Effect probably damaging
Transcript: ENSMUST00000022622
AA Change: V634D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: V634D

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089250
AA Change: V634D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456
AA Change: V634D

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111121
AA Change: V634D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: V634D

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127083
Predicted Effect probably damaging
Transcript: ENSMUST00000154865
AA Change: V37D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456
AA Change: V37D

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178730
AA Change: V634D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: V634D

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Ptk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Ptk2b APN 14 66177118 missense possibly damaging 0.54
IGL01940:Ptk2b APN 14 66158613 missense probably benign 0.00
IGL02121:Ptk2b APN 14 66213482 missense probably benign 0.12
IGL02505:Ptk2b APN 14 66154243 missense probably damaging 1.00
IGL03036:Ptk2b APN 14 66173895 splice site probably benign
IGL03343:Ptk2b APN 14 66169421 missense probably benign 0.10
FR4548:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
FR4737:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
R0217:Ptk2b UTSW 14 66156381 missense probably damaging 1.00
R0478:Ptk2b UTSW 14 66213372 missense probably damaging 1.00
R0556:Ptk2b UTSW 14 66172144 missense probably damaging 1.00
R0631:Ptk2b UTSW 14 66177751 missense probably damaging 0.96
R0946:Ptk2b UTSW 14 66158598 missense probably benign 0.02
R1502:Ptk2b UTSW 14 66163080 missense possibly damaging 0.95
R1583:Ptk2b UTSW 14 66163114 missense possibly damaging 0.75
R1876:Ptk2b UTSW 14 66158392 missense probably benign 0.01
R1905:Ptk2b UTSW 14 66158670 missense probably damaging 1.00
R2048:Ptk2b UTSW 14 66172505 missense probably benign 0.28
R2377:Ptk2b UTSW 14 66172548 missense possibly damaging 0.56
R3021:Ptk2b UTSW 14 66178183 splice site probably null
R3793:Ptk2b UTSW 14 66170251 missense probably damaging 1.00
R3836:Ptk2b UTSW 14 66156342 missense probably damaging 1.00
R3911:Ptk2b UTSW 14 66157068 missense possibly damaging 0.83
R4654:Ptk2b UTSW 14 66163047 missense possibly damaging 0.86
R4690:Ptk2b UTSW 14 66173300 splice site probably null
R4691:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4692:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4693:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4847:Ptk2b UTSW 14 66173882 missense probably damaging 1.00
R5176:Ptk2b UTSW 14 66156415 missense probably damaging 1.00
R5297:Ptk2b UTSW 14 66172517 missense probably benign 0.04
R5603:Ptk2b UTSW 14 66172065 nonsense probably null
R5935:Ptk2b UTSW 14 66173879 missense probably damaging 1.00
R6245:Ptk2b UTSW 14 66163066 missense probably damaging 1.00
R6313:Ptk2b UTSW 14 66178831 missense probably damaging 1.00
R6476:Ptk2b UTSW 14 66187474 missense possibly damaging 0.81
R6858:Ptk2b UTSW 14 66213398 missense probably damaging 1.00
R7235:Ptk2b UTSW 14 66157087 nonsense probably null
R7511:Ptk2b UTSW 14 66154244 missense possibly damaging 0.81
R7558:Ptk2b UTSW 14 66154179 missense possibly damaging 0.83
R7838:Ptk2b UTSW 14 66158401 missense probably benign
R7921:Ptk2b UTSW 14 66158401 missense probably benign
X0054:Ptk2b UTSW 14 66213328 missense probably benign 0.15
Y5405:Ptk2b UTSW 14 66154094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAACAAAGATACCCACTGC -3'
(R):5'- CTCAAGGGAGATTGTGCCTC -3'

Sequencing Primer
(F):5'- AGCATCTGCAGCGTCATC -3'
(R):5'- GAGATTGTGCCTCCTCCAG -3'
Posted On2014-08-01