Incidental Mutation 'R1942:Muc19'
ID216326
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Namemucin 19
Synonymsapomucin, sld
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91838326-91934555 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 91892472 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178108
SMART Domains Protein: ENSMUSP00000136475
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
VWD 30 181 1.31e-13 SMART
Pfam:C8 200 277 2.5e-8 PFAM
Pfam:TIL 281 336 7.5e-12 PFAM
Pfam:VWD 377 477 4.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180042
SMART Domains Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
C8 17 91 8.71e-20 SMART
Pfam:TIL 94 151 1.2e-7 PFAM
Pfam:TIL 193 253 6.6e-8 PFAM
VWD 282 445 2.36e-47 SMART
C8 481 555 1.84e-27 SMART
low complexity region 660 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91886749 exon noncoding transcript
IGL01017:Muc19 APN 15 91880707 exon noncoding transcript
IGL01140:Muc19 APN 15 91899399 exon noncoding transcript
IGL01292:Muc19 APN 15 91894276 exon noncoding transcript
IGL01397:Muc19 APN 15 91894304 exon noncoding transcript
IGL01525:Muc19 APN 15 91886683 exon noncoding transcript
IGL01589:Muc19 APN 15 91870501 exon noncoding transcript
IGL02023:Muc19 APN 15 91888259 exon noncoding transcript
IGL02088:Muc19 APN 15 91891168 splice site noncoding transcript
IGL02168:Muc19 APN 15 91894098 exon noncoding transcript
IGL02343:Muc19 APN 15 91894234 exon noncoding transcript
IGL02402:Muc19 APN 15 91893998 splice site noncoding transcript
IGL02433:Muc19 APN 15 91872496 exon noncoding transcript
IGL02533:Muc19 APN 15 91898047 exon noncoding transcript
IGL02558:Muc19 APN 15 91897622 exon noncoding transcript
IGL02652:Muc19 APN 15 91877815 critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91910539 unclassified noncoding transcript
IGL02837:Muc19 UTSW 15 91882656 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0208:Muc19 UTSW 15 91893024 splice site noncoding transcript
R0597:Muc19 UTSW 15 91900502 splice site noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1469:Muc19 UTSW 15 91874300 unclassified noncoding transcript
R2035:Muc19 UTSW 15 91892405 splice site noncoding transcript
R2208:Muc19 UTSW 15 91871549 exon noncoding transcript
R2877:Muc19 UTSW 15 91893006 exon noncoding transcript
R2897:Muc19 UTSW 15 91924665 critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91897622 exon noncoding transcript
R4403:Muc19 UTSW 15 91871570 exon noncoding transcript
R4606:Muc19 UTSW 15 91934383 exon noncoding transcript
R4677:Muc19 UTSW 15 91888217 exon noncoding transcript
R4753:Muc19 UTSW 15 91877761 unclassified noncoding transcript
R4781:Muc19 UTSW 15 91903166 critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91897716 exon noncoding transcript
R5000:Muc19 UTSW 15 91873231 unclassified noncoding transcript
R5044:Muc19 UTSW 15 91888138 exon noncoding transcript
R5156:Muc19 UTSW 15 91900420 exon noncoding transcript
R5176:Muc19 UTSW 15 91892180 exon noncoding transcript
R5224:Muc19 UTSW 15 91928025 exon noncoding transcript
R5524:Muc19 UTSW 15 91894393 exon noncoding transcript
R5568:Muc19 UTSW 15 91884274 splice site noncoding transcript
R5592:Muc19 UTSW 15 91930314 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATTTGTGTGTCTGCATGATCCC -3'
(R):5'- GCCATTGTTCTTGAGATAGTCCTCTG -3'

Sequencing Primer
(F):5'- CTTGTACTTGTCAAATGTGGACC -3'
(R):5'- TCTTGAGATAGTCCTCTGTGTAAC -3'
Posted On2014-08-01