Incidental Mutation 'R1943:Il1rn'
ID216345
Institutional Source Beutler Lab
Gene Symbol Il1rn
Ensembl Gene ENSMUSG00000026981
Gene Nameinterleukin 1 receptor antagonist
SynonymsF630041P17Rik, IL-1ra
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1943 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location24336853-24351494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24348599 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 82 (S82P)
Ref Sequence ENSEMBL: ENSMUSP00000110129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114482] [ENSMUST00000114485] [ENSMUST00000114487] [ENSMUST00000142093]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114482
AA Change: S98P

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110126
Gene: ENSMUSG00000026981
AA Change: S98P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL1 34 175 2.88e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114485
AA Change: S82P

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110129
Gene: ENSMUSG00000026981
AA Change: S82P

DomainStartEndE-ValueType
IL1 18 159 2.88e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114487
AA Change: S79P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110131
Gene: ENSMUSG00000026981
AA Change: S79P

DomainStartEndE-ValueType
IL1 15 156 2.88e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142093
SMART Domains Protein: ENSMUSP00000141269
Gene: ENSMUSG00000026981

DomainStartEndE-ValueType
PDB:1IRP|A 8 50 1e-21 PDB
Blast:IL1 15 50 9e-20 BLAST
SCOP:d1ilr1_ 16 50 3e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143423
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jan 2016]
PHENOTYPE: Nullizygous mutations of this gene may result in decreased body weight, increased inflammatory response to turpentine and LPS, decreased susceptibility to bacterial infection, psoriasis, aortitis, rheumatoid arthritis, and abnormal dendritic and CD4-positive T cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Fh1 C T 1: 175,609,778 V252I probably benign Het
Gm13199 C T 2: 5,862,706 probably benign Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr169 A T 16: 19,566,437 W149R probably benign Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Parp14 A G 16: 35,836,129 Y1676H probably damaging Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Rsph6a A C 7: 19,074,076 Y388S probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Sf3a3 A G 4: 124,715,901 K97E possibly damaging Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Slc7a10 T A 7: 35,200,298 V435E probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem2 G A 19: 21,848,040 probably null Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Zfp715 A T 7: 43,299,630 V302E possibly damaging Het
Other mutations in Il1rn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Il1rn APN 2 24349539 missense probably damaging 1.00
IGL02606:Il1rn APN 2 24345450 intron probably benign
R1251:Il1rn UTSW 2 24345570 missense probably damaging 1.00
R4284:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R4285:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R4287:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R5317:Il1rn UTSW 2 24349542 missense probably benign 0.30
R5322:Il1rn UTSW 2 24348629 critical splice donor site probably null
R6662:Il1rn UTSW 2 24336875 start gained probably null
R7427:Il1rn UTSW 2 24349542 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GATAGAGCCTTCTTGACCTTCTTG -3'
(R):5'- AAGACCCATGGTGGTTCAGG -3'

Sequencing Primer
(F):5'- TCTTGACCTTCTTGACCTTCTAG -3'
(R):5'- AGTTGGTCACCACGCTTAAG -3'
Posted On2014-08-01