Incidental Mutation 'R1943:Sf3a3'
ID 216361
Institutional Source Beutler Lab
Gene Symbol Sf3a3
Ensembl Gene ENSMUSG00000028902
Gene Name splicing factor 3a, subunit 3
Synonyms 4930512K19Rik, 60kDa
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R1943 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 124714776-124732460 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124715901 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 97 (K97E)
Ref Sequence ENSEMBL: ENSMUSP00000030734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030734]
AlphaFold Q9D554
Predicted Effect possibly damaging
Transcript: ENSMUST00000030734
AA Change: K97E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030734
Gene: ENSMUSG00000028902
AA Change: K97E

DomainStartEndE-ValueType
Pfam:SF3a60_bindingd 74 100 3e-19 PFAM
Pfam:SF3A3 129 207 7.9e-27 PFAM
Pfam:Telomere_Sde2_2 244 303 3.1e-31 PFAM
low complexity region 354 377 N/A INTRINSIC
ZnF_C2H2 406 431 9.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154712
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Fh1 C T 1: 175,609,778 V252I probably benign Het
Gm13199 C T 2: 5,862,706 probably benign Het
Il1rn T C 2: 24,348,599 S82P possibly damaging Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr169 A T 16: 19,566,437 W149R probably benign Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Parp14 A G 16: 35,836,129 Y1676H probably damaging Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Rsph6a A C 7: 19,074,076 Y388S probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Slc7a10 T A 7: 35,200,298 V435E probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem2 G A 19: 21,848,040 probably null Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Zfp715 A T 7: 43,299,630 V302E possibly damaging Het
Other mutations in Sf3a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
IGL01623:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
PIT4495001:Sf3a3 UTSW 4 124728320 missense probably damaging 1.00
R0070:Sf3a3 UTSW 4 124714955 missense probably benign 0.04
R1441:Sf3a3 UTSW 4 124725142 missense probably damaging 0.99
R1858:Sf3a3 UTSW 4 124729495 missense probably damaging 1.00
R1928:Sf3a3 UTSW 4 124722093 missense possibly damaging 0.56
R2101:Sf3a3 UTSW 4 124718343 missense possibly damaging 0.93
R2984:Sf3a3 UTSW 4 124718409 missense probably damaging 1.00
R3434:Sf3a3 UTSW 4 124725077 missense possibly damaging 0.95
R4366:Sf3a3 UTSW 4 124725139 missense probably benign
R4711:Sf3a3 UTSW 4 124728181 missense probably benign 0.01
R5032:Sf3a3 UTSW 4 124725166 missense probably benign 0.17
R5464:Sf3a3 UTSW 4 124728240 critical splice donor site probably null
R5607:Sf3a3 UTSW 4 124714953 missense probably damaging 1.00
R5997:Sf3a3 UTSW 4 124722058 missense probably damaging 0.99
R6166:Sf3a3 UTSW 4 124723384 intron probably benign
R7030:Sf3a3 UTSW 4 124722880 missense probably damaging 1.00
R7038:Sf3a3 UTSW 4 124728426 missense probably benign 0.16
R7157:Sf3a3 UTSW 4 124722900 missense probably damaging 0.98
R7184:Sf3a3 UTSW 4 124714979 missense probably benign 0.10
R7250:Sf3a3 UTSW 4 124722915 missense probably benign 0.03
R9212:Sf3a3 UTSW 4 124728128 missense possibly damaging 0.67
Z1176:Sf3a3 UTSW 4 124714901 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACGGTCACATCCCTTCTAAC -3'
(R):5'- ACATTCTTGTGAAGCAGCCC -3'

Sequencing Primer
(F):5'- ACAATTAGTGCTTTTGAGGAGCCC -3'
(R):5'- CATTCTTGTGAAGCAGCCCTAGTG -3'
Posted On 2014-08-01