Incidental Mutation 'R0131:Tet3'
ID 21637
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Name tet methylcytosine dioxygenase 3
Synonyms B430006D22Rik, D230004J03Rik
MMRRC Submission 038416-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.640) question?
Stock # R0131 (G1)
Quality Score 191
Status Validated (trace)
Chromosome 6
Chromosomal Location 83339355-83434190 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 83345770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1556 (G1556R)
Ref Sequence ENSEMBL: ENSMUSP00000139630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548]
AlphaFold Q8BG87
Predicted Effect possibly damaging
Transcript: ENSMUST00000089622
AA Change: G1421R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: G1421R

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186548
AA Change: G1556R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: G1556R

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 90.2%
  • 20x: 71.5%
Validation Efficiency 87% (52/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,833,115 (GRCm39) Q1195L possibly damaging Het
Abcc12 A G 8: 87,258,197 (GRCm39) I773T probably benign Het
Adamtsl1 T A 4: 86,260,960 (GRCm39) I1057N possibly damaging Het
Adgrv1 A T 13: 81,651,114 (GRCm39) probably benign Het
Anxa5 G A 3: 36,504,821 (GRCm39) A247V probably damaging Het
Ascc3 T G 10: 50,611,425 (GRCm39) W1589G probably damaging Het
Atp2b2 G A 6: 113,770,743 (GRCm39) P389S probably damaging Het
Bicd1 A G 6: 149,414,445 (GRCm39) E386G probably damaging Het
Bmal2 C A 6: 146,729,601 (GRCm39) H471N probably benign Het
Bpifa6 T A 2: 153,824,851 (GRCm39) S9T probably benign Het
Cacna1c T C 6: 118,602,473 (GRCm39) I1428V probably damaging Het
Cfhr4 T A 1: 139,682,009 (GRCm39) T196S probably damaging Het
Chd8 A G 14: 52,442,783 (GRCm39) V589A probably benign Het
Chrnb2 T C 3: 89,671,713 (GRCm39) M1V probably null Het
Cldnd1 T C 16: 58,553,355 (GRCm39) L232P probably damaging Het
Col16a1 T A 4: 129,960,889 (GRCm39) V449E unknown Het
Col3a1 T A 1: 45,368,028 (GRCm39) probably benign Het
Cttnbp2nl T G 3: 104,913,173 (GRCm39) K237T probably damaging Het
Cyc1 G A 15: 76,229,159 (GRCm39) V142I probably benign Het
Dapk3 A G 10: 81,028,141 (GRCm39) T265A probably benign Het
Ddx21 A T 10: 62,420,531 (GRCm39) M711K possibly damaging Het
Dlg5 A T 14: 24,188,717 (GRCm39) L1735Q probably damaging Het
Dse A G 10: 34,029,660 (GRCm39) Y341H probably damaging Het
Elmod2 A G 8: 84,046,133 (GRCm39) I148T probably damaging Het
Fam187b T A 7: 30,688,545 (GRCm39) V22E probably damaging Het
Faxc A G 4: 21,936,659 (GRCm39) D98G probably damaging Het
Fcgbpl1 A G 7: 27,837,040 (GRCm39) R320G probably damaging Het
Fcrl2 A G 3: 87,166,266 (GRCm39) S170P possibly damaging Het
Fsip2 G A 2: 82,821,465 (GRCm39) D5733N probably benign Het
Gbe1 T C 16: 70,157,740 (GRCm39) probably benign Het
Gm6327 T C 16: 12,578,909 (GRCm39) noncoding transcript Het
H2-T24 T A 17: 36,325,878 (GRCm39) I238F probably damaging Het
Hectd4 A G 5: 121,471,087 (GRCm39) E2658G probably benign Het
Herc1 A C 9: 66,388,192 (GRCm39) I3826L probably benign Het
Hinfp A G 9: 44,211,060 (GRCm39) C67R probably damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Hspg2 T C 4: 137,279,198 (GRCm39) Y3094H probably damaging Het
Htr1f A G 16: 64,747,091 (GRCm39) V67A probably damaging Het
Idi2l T A 13: 8,990,563 (GRCm39) probably benign Het
Iqcc T G 4: 129,510,392 (GRCm39) E374D probably damaging Het
Kcnj9 T C 1: 172,153,765 (GRCm39) T120A probably damaging Het
Kitl C T 10: 99,923,226 (GRCm39) P208S probably benign Het
Kmt2b A T 7: 30,283,346 (GRCm39) C296S probably damaging Het
Lgals4 A G 7: 28,533,657 (GRCm39) probably null Het
Lpcat4 A G 2: 112,077,093 (GRCm39) Y479C probably damaging Het
Lrrc74b T C 16: 17,371,016 (GRCm39) N227S probably damaging Het
Mdc1 T A 17: 36,163,473 (GRCm39) V1007D probably damaging Het
Mocos T G 18: 24,812,819 (GRCm39) I571S probably benign Het
Myh8 A G 11: 67,183,014 (GRCm39) N659D probably damaging Het
Mylk T C 16: 34,695,874 (GRCm39) V203A probably benign Het
Myom2 A G 8: 15,133,329 (GRCm39) N407S probably damaging Het
Naip2 A G 13: 100,320,296 (GRCm39) V240A probably benign Het
Nap1l1 T C 10: 111,321,370 (GRCm39) S37P probably benign Het
Nin T G 12: 70,097,915 (GRCm39) K515T probably damaging Het
Npl T A 1: 153,384,864 (GRCm39) K258* probably null Het
Ntn4 T A 10: 93,480,569 (GRCm39) S98T possibly damaging Het
Or10x1 T C 1: 174,197,152 (GRCm39) V223A probably damaging Het
Or2t6 T C 14: 14,175,620 (GRCm38) D154G probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5k14 C A 16: 58,693,269 (GRCm39) M81I probably benign Het
Or8u10 T C 2: 85,915,844 (GRCm39) I92M probably damaging Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Pate3 A G 9: 35,557,453 (GRCm39) C68R probably damaging Het
Pcdh15 A G 10: 74,006,440 (GRCm39) D106G probably null Het
Ppox C A 1: 171,106,849 (GRCm39) A192S possibly damaging Het
Prkdc T C 16: 15,531,517 (GRCm39) L1380S probably benign Het
Proc C T 18: 32,268,951 (GRCm39) M11I probably benign Het
Psd4 C A 2: 24,295,363 (GRCm39) A839E probably damaging Het
Psg21 A G 7: 18,388,793 (GRCm39) Y100H probably benign Het
Pten T A 19: 32,753,469 (GRCm39) V45E probably benign Het
Ptprn2 T G 12: 116,685,711 (GRCm39) F57V probably damaging Het
Ptprt C T 2: 162,120,030 (GRCm39) V146I probably benign Het
R3hdm2 T A 10: 127,334,322 (GRCm39) M915K probably damaging Het
Rab26 C T 17: 24,749,759 (GRCm39) probably null Het
Rab7b T C 1: 131,626,293 (GRCm39) L107P probably damaging Het
Rbm47 T A 5: 66,183,872 (GRCm39) T244S possibly damaging Het
Rhbdf2 C A 11: 116,496,170 (GRCm39) G122C probably damaging Het
Rnf213 A G 11: 119,321,187 (GRCm39) E1215G probably benign Het
Rprd2 T C 3: 95,681,673 (GRCm39) K407E probably damaging Het
Siah3 G A 14: 75,693,574 (GRCm39) V27I possibly damaging Het
Slc12a3 G A 8: 95,067,511 (GRCm39) probably benign Het
Slc14a2 T A 18: 78,235,338 (GRCm39) N280Y probably damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc25a35 A G 11: 68,862,786 (GRCm39) Y247C probably damaging Het
Slc29a4 A G 5: 142,691,285 (GRCm39) D55G probably benign Het
Slc35d1 C T 4: 103,065,378 (GRCm39) V189I probably benign Het
Spg11 T C 2: 121,901,449 (GRCm39) E1497G probably damaging Het
Srrm1 G A 4: 135,067,884 (GRCm39) R322* probably null Het
Stac3 A T 10: 127,339,519 (GRCm39) R138S probably damaging Het
Tgfbr3 A G 5: 107,280,682 (GRCm39) S693P probably benign Het
Tmcc2 C T 1: 132,308,444 (GRCm39) G150D probably benign Het
Tmem216 T C 19: 10,531,970 (GRCm39) Y44C probably damaging Het
Tmem260 T A 14: 48,720,779 (GRCm39) C306* probably null Het
Tspyl1 A G 10: 34,159,085 (GRCm39) N270S probably damaging Het
Ubr4 A G 4: 139,191,362 (GRCm39) T4127A possibly damaging Het
Ugt2a2 T A 5: 87,622,720 (GRCm39) K293* probably null Het
Vmn2r102 A C 17: 19,899,025 (GRCm39) T456P probably benign Het
Vmn2r90 T A 17: 17,932,511 (GRCm39) S139R probably benign Het
Wrnip1 G A 13: 32,990,847 (GRCm39) V369I probably damaging Het
Zc3h12c T A 9: 52,037,923 (GRCm39) I305F possibly damaging Het
Zmym2 A G 14: 57,180,715 (GRCm39) N876D probably benign Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83,345,637 (GRCm39) missense probably benign 0.06
IGL01396:Tet3 APN 6 83,346,620 (GRCm39) nonsense probably null
IGL02344:Tet3 APN 6 83,380,815 (GRCm39) missense probably benign 0.04
IGL02987:Tet3 APN 6 83,345,074 (GRCm39) missense probably damaging 0.99
IGL03126:Tet3 APN 6 83,353,769 (GRCm39) missense probably damaging 1.00
IGL03155:Tet3 APN 6 83,345,365 (GRCm39) missense probably damaging 1.00
IGL03286:Tet3 APN 6 83,352,760 (GRCm39) missense probably damaging 1.00
Reedy UTSW 6 83,345,066 (GRCm39) nonsense probably null
P0033:Tet3 UTSW 6 83,345,494 (GRCm39) missense probably damaging 1.00
R0295:Tet3 UTSW 6 83,346,121 (GRCm39) missense probably benign 0.14
R0504:Tet3 UTSW 6 83,350,776 (GRCm39) missense probably damaging 1.00
R0524:Tet3 UTSW 6 83,356,924 (GRCm39) missense probably damaging 1.00
R1061:Tet3 UTSW 6 83,350,305 (GRCm39) missense probably damaging 0.99
R1160:Tet3 UTSW 6 83,381,434 (GRCm39) missense probably benign 0.00
R1550:Tet3 UTSW 6 83,363,010 (GRCm39) missense probably damaging 0.97
R1640:Tet3 UTSW 6 83,346,297 (GRCm39) missense probably benign 0.44
R1658:Tet3 UTSW 6 83,346,039 (GRCm39) missense probably benign 0.44
R1746:Tet3 UTSW 6 83,345,050 (GRCm39) missense probably damaging 1.00
R1761:Tet3 UTSW 6 83,380,641 (GRCm39) missense probably damaging 0.99
R1832:Tet3 UTSW 6 83,380,627 (GRCm39) missense probably benign
R1835:Tet3 UTSW 6 83,381,145 (GRCm39) missense possibly damaging 0.95
R1932:Tet3 UTSW 6 83,381,361 (GRCm39) missense possibly damaging 0.94
R2014:Tet3 UTSW 6 83,363,057 (GRCm39) missense probably damaging 1.00
R2230:Tet3 UTSW 6 83,346,453 (GRCm39) missense probably damaging 1.00
R2232:Tet3 UTSW 6 83,346,453 (GRCm39) missense probably damaging 1.00
R2922:Tet3 UTSW 6 83,345,494 (GRCm39) missense probably damaging 1.00
R3429:Tet3 UTSW 6 83,380,401 (GRCm39) missense probably damaging 1.00
R3430:Tet3 UTSW 6 83,380,401 (GRCm39) missense probably damaging 1.00
R4291:Tet3 UTSW 6 83,350,181 (GRCm39) missense probably damaging 1.00
R4349:Tet3 UTSW 6 83,380,257 (GRCm39) missense probably benign
R4809:Tet3 UTSW 6 83,379,928 (GRCm39) missense probably benign
R4846:Tet3 UTSW 6 83,353,865 (GRCm39) nonsense probably null
R5039:Tet3 UTSW 6 83,352,878 (GRCm39) missense probably damaging 1.00
R5233:Tet3 UTSW 6 83,363,045 (GRCm39) missense probably damaging 1.00
R5363:Tet3 UTSW 6 83,353,746 (GRCm39) critical splice donor site probably null
R5880:Tet3 UTSW 6 83,347,532 (GRCm39) missense probably damaging 1.00
R6270:Tet3 UTSW 6 83,352,773 (GRCm39) missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83,345,066 (GRCm39) nonsense probably null
R6564:Tet3 UTSW 6 83,363,052 (GRCm39) missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83,380,426 (GRCm39) missense probably benign 0.00
R7089:Tet3 UTSW 6 83,432,006 (GRCm39) missense possibly damaging 0.46
R7244:Tet3 UTSW 6 83,347,603 (GRCm39) missense probably damaging 1.00
R7251:Tet3 UTSW 6 83,381,038 (GRCm39) missense probably benign
R7361:Tet3 UTSW 6 83,345,076 (GRCm39) missense probably benign 0.15
R7436:Tet3 UTSW 6 83,345,211 (GRCm39) small insertion probably benign
R7438:Tet3 UTSW 6 83,345,211 (GRCm39) small insertion probably benign
R7544:Tet3 UTSW 6 83,381,623 (GRCm39) missense probably damaging 1.00
R7552:Tet3 UTSW 6 83,345,289 (GRCm39) missense probably damaging 1.00
R7942:Tet3 UTSW 6 83,353,956 (GRCm39) missense probably damaging 1.00
R8010:Tet3 UTSW 6 83,380,228 (GRCm39) missense unknown
R8063:Tet3 UTSW 6 83,379,723 (GRCm39) missense probably damaging 1.00
R8307:Tet3 UTSW 6 83,356,909 (GRCm39) missense probably damaging 1.00
R9016:Tet3 UTSW 6 83,345,253 (GRCm39) missense probably damaging 1.00
R9020:Tet3 UTSW 6 83,381,418 (GRCm39) missense probably damaging 1.00
R9377:Tet3 UTSW 6 83,380,596 (GRCm39) missense possibly damaging 0.95
R9476:Tet3 UTSW 6 83,381,808 (GRCm39) critical splice acceptor site probably null
R9476:Tet3 UTSW 6 83,380,935 (GRCm39) missense possibly damaging 0.91
R9510:Tet3 UTSW 6 83,381,808 (GRCm39) critical splice acceptor site probably null
R9510:Tet3 UTSW 6 83,380,935 (GRCm39) missense possibly damaging 0.91
R9582:Tet3 UTSW 6 83,381,226 (GRCm39) missense probably damaging 0.99
R9671:Tet3 UTSW 6 83,381,136 (GRCm39) missense possibly damaging 0.89
R9801:Tet3 UTSW 6 83,346,436 (GRCm39) missense possibly damaging 0.94
X0004:Tet3 UTSW 6 83,380,405 (GRCm39) missense probably benign 0.17
Z1176:Tet3 UTSW 6 83,436,003 (GRCm39) missense unknown
Z1176:Tet3 UTSW 6 83,381,332 (GRCm39) missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83,347,680 (GRCm39) missense probably damaging 1.00
Z1177:Tet3 UTSW 6 83,381,276 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTGTTCACTGTCCGACCACAGTTC -3'
(R):5'- AGCCCTACCATTGTTCCCGACAAG -3'

Sequencing Primer
(F):5'- GACCACAGTTCCTCCTCG -3'
(R):5'- CGACAAGCTCAATTCTTTTGGGG -3'
Posted On 2013-04-11