Incidental Mutation 'R1943:Rsph6a'
ID216374
Institutional Source Beutler Lab
Gene Symbol Rsph6a
Ensembl Gene ENSMUSG00000040866
Gene Nameradial spoke head 6 homolog A (Chlamydomonas)
SynonymsRSP4, Rshl1
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1943 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19054690-19074447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 19074076 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 388 (Y388S)
Ref Sequence ENSEMBL: ENSMUSP00000076153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032570] [ENSMUST00000035521] [ENSMUST00000076887] [ENSMUST00000108479]
Predicted Effect probably benign
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000035521
AA Change: Y643S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866
AA Change: Y643S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076887
AA Change: Y388S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866
AA Change: Y388S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a sea urchin radial spoke head protein. Radial spoke protein complexes form part of the axoneme of eukaryotic flagella and are located between the axoneme's outer ring of doublet microtubules and central pair of microtubules. In Chlamydomonas, radial spoke proteins are thought to regulate the activity of dynein and the symmetry of flagellar bending patterns. This gene maps to a region of chromosome 19 that is linked to primary ciliary dyskinesia-2 (CILD2). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Fh1 C T 1: 175,609,778 V252I probably benign Het
Gm13199 C T 2: 5,862,706 probably benign Het
Il1rn T C 2: 24,348,599 S82P possibly damaging Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr169 A T 16: 19,566,437 W149R probably benign Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Parp14 A G 16: 35,836,129 Y1676H probably damaging Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Sf3a3 A G 4: 124,715,901 K97E possibly damaging Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Slc7a10 T A 7: 35,200,298 V435E probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem2 G A 19: 21,848,040 probably null Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Zfp715 A T 7: 43,299,630 V302E possibly damaging Het
Other mutations in Rsph6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Rsph6a APN 7 19054868 nonsense probably null
IGL01656:Rsph6a APN 7 19054845 missense probably benign 0.00
IGL02997:Rsph6a APN 7 19054839 missense probably benign 0.32
R0396:Rsph6a UTSW 7 19074106 missense probably damaging 1.00
R0467:Rsph6a UTSW 7 19057669 missense possibly damaging 0.95
R0545:Rsph6a UTSW 7 19054946 nonsense probably null
R0603:Rsph6a UTSW 7 19065961 missense possibly damaging 0.66
R0848:Rsph6a UTSW 7 19057670 missense probably benign 0.07
R2133:Rsph6a UTSW 7 19068106 missense probably damaging 1.00
R3713:Rsph6a UTSW 7 19057550 missense probably damaging 0.98
R3762:Rsph6a UTSW 7 19055331 missense probably damaging 1.00
R3826:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3827:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R3828:Rsph6a UTSW 7 19057614 missense probably damaging 1.00
R4355:Rsph6a UTSW 7 19067078 splice site probably null
R4429:Rsph6a UTSW 7 19074063 missense probably damaging 1.00
R4524:Rsph6a UTSW 7 19066045 missense probably damaging 1.00
R4799:Rsph6a UTSW 7 19065858 nonsense probably null
R4896:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R4906:Rsph6a UTSW 7 19068072 missense possibly damaging 0.92
R5004:Rsph6a UTSW 7 19057740 missense possibly damaging 0.67
R5637:Rsph6a UTSW 7 19054895 missense probably benign
R6066:Rsph6a UTSW 7 19065815 missense probably damaging 1.00
R7013:Rsph6a UTSW 7 19054895 missense probably benign
R7193:Rsph6a UTSW 7 19065647 missense probably damaging 1.00
R7689:Rsph6a UTSW 7 19068037 missense possibly damaging 0.64
R8170:Rsph6a UTSW 7 19057580 missense probably damaging 1.00
R8177:Rsph6a UTSW 7 19074239 missense unknown
Z1177:Rsph6a UTSW 7 19065931 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTTTTGTGGGAGGGACAG -3'
(R):5'- ATCTGTTGCTACGAATAAGGGG -3'

Sequencing Primer
(F):5'- TTTGTGGGAGGGACAGATGGAC -3'
(R):5'- AAGGAGCTTGGGGCCTCAG -3'
Posted On2014-08-01