Incidental Mutation 'R1943:Slc7a10'
ID216375
Institutional Source Beutler Lab
Gene Symbol Slc7a10
Ensembl Gene ENSMUSG00000030495
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 10
SynonymsD7Bwg0847e, Asc-1
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1943 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location35186385-35201114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35200298 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 435 (V435E)
Ref Sequence ENSEMBL: ENSMUSP00000001854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001854] [ENSMUST00000118444] [ENSMUST00000122409] [ENSMUST00000131048] [ENSMUST00000135452] [ENSMUST00000167441]
Predicted Effect probably benign
Transcript: ENSMUST00000001854
AA Change: V435E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000001854
Gene: ENSMUSG00000030495
AA Change: V435E

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 474 4.8e-65 PFAM
Pfam:AA_permease 51 467 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118444
SMART Domains Protein: ENSMUSP00000113406
Gene: ENSMUSG00000001802

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 43 159 9.97e-20 SMART
LDLa 165 202 7.21e-11 SMART
LDLa 211 251 1.37e-11 SMART
CUB 254 365 1.98e-3 SMART
LDLa 367 414 1.85e-1 SMART
LDLa 415 453 4.44e-3 SMART
LDLa 454 490 8.74e-10 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 584 606 N/A INTRINSIC
low complexity region 641 652 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122409
SMART Domains Protein: ENSMUSP00000114026
Gene: ENSMUSG00000001802

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 64 180 9.97e-20 SMART
LDLa 186 223 7.21e-11 SMART
LDLa 232 272 1.37e-11 SMART
CUB 275 386 1.98e-3 SMART
LDLa 388 435 1.85e-1 SMART
LDLa 436 474 4.44e-3 SMART
LDLa 475 511 8.74e-10 SMART
transmembrane domain 518 540 N/A INTRINSIC
low complexity region 605 627 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131048
SMART Domains Protein: ENSMUSP00000118331
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 346 8.6e-48 PFAM
Pfam:AA_permease 51 346 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135452
SMART Domains Protein: ENSMUSP00000127577
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 125 1.5e-15 PFAM
Pfam:AA_permease 51 125 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155404
Predicted Effect probably benign
Transcript: ENSMUST00000167441
SMART Domains Protein: ENSMUSP00000129954
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC7A10, in association with 4F2HC (SLC3A2; MIM 158070), mediates high-affinity transport of D-serine and several other neutral amino acids (Nakauchi et al., 2000 [PubMed 10863037]).[supplied by OMIM, Mar 2008]
PHENOTYPE: A targeted mutation of this gene results in mice that develop tremors, ataxia and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Fh1 C T 1: 175,609,778 V252I probably benign Het
Gm13199 C T 2: 5,862,706 probably benign Het
Il1rn T C 2: 24,348,599 S82P possibly damaging Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr169 A T 16: 19,566,437 W149R probably benign Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Parp14 A G 16: 35,836,129 Y1676H probably damaging Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Rsph6a A C 7: 19,074,076 Y388S probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Sf3a3 A G 4: 124,715,901 K97E possibly damaging Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem2 G A 19: 21,848,040 probably null Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Zfp715 A T 7: 43,299,630 V302E possibly damaging Het
Other mutations in Slc7a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Slc7a10 APN 7 35186492 missense possibly damaging 0.90
IGL02728:Slc7a10 APN 7 35197698 missense probably damaging 1.00
IGL02892:Slc7a10 APN 7 35195168 missense possibly damaging 0.67
R0671:Slc7a10 UTSW 7 35197333 missense probably benign 0.00
R3743:Slc7a10 UTSW 7 35198900 missense probably damaging 0.99
R4256:Slc7a10 UTSW 7 35198715 missense probably damaging 0.96
R4583:Slc7a10 UTSW 7 35197952 critical splice donor site probably null
R4638:Slc7a10 UTSW 7 35197930 missense probably damaging 1.00
R4749:Slc7a10 UTSW 7 35200762 missense probably damaging 1.00
R5023:Slc7a10 UTSW 7 35197355 missense possibly damaging 0.48
R5755:Slc7a10 UTSW 7 35198911 missense probably damaging 0.99
R6247:Slc7a10 UTSW 7 35186587 missense possibly damaging 0.57
R6430:Slc7a10 UTSW 7 35197658 missense probably benign
R6450:Slc7a10 UTSW 7 35186590 missense possibly damaging 0.83
R6814:Slc7a10 UTSW 7 35195264 missense probably damaging 0.98
R7026:Slc7a10 UTSW 7 35198714 missense probably damaging 1.00
R7110:Slc7a10 UTSW 7 35199584 missense probably benign
R7923:Slc7a10 UTSW 7 35195129 missense probably damaging 0.98
R8000:Slc7a10 UTSW 7 35200440 missense
Z1176:Slc7a10 UTSW 7 35200330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTTAGCAGTTTGGCC -3'
(R):5'- GATCCTACAAGAGGCATGGTGG -3'

Sequencing Primer
(F):5'- TGGTCAACCCAGGAATTGCTC -3'
(R):5'- ATGGTGGCAAGACCCTTCTCAC -3'
Posted On2014-08-01