Incidental Mutation 'R1943:Zfp715'
ID216376
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Namezinc finger protein 715
Synonymsmszf15, 2610041B18Rik
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1943 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43296197-43313294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43299630 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 302 (V302E)
Ref Sequence ENSEMBL: ENSMUSP00000103620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
Predicted Effect probably benign
Transcript: ENSMUST00000012796
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000048015
AA Change: V302E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: V302E

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107986
AA Change: V302E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: V302E

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135130
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139061
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151659
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Fh1 C T 1: 175,609,778 V252I probably benign Het
Gm13199 C T 2: 5,862,706 probably benign Het
Il1rn T C 2: 24,348,599 S82P possibly damaging Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr169 A T 16: 19,566,437 W149R probably benign Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Parp14 A G 16: 35,836,129 Y1676H probably damaging Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Rsph6a A C 7: 19,074,076 Y388S probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Sf3a3 A G 4: 124,715,901 K97E possibly damaging Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Slc7a10 T A 7: 35,200,298 V435E probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem2 G A 19: 21,848,040 probably null Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2073:Zfp715 UTSW 7 43311120 missense probably benign 0.01
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R2403:Zfp715 UTSW 7 43299268 missense possibly damaging 0.91
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4426:Zfp715 UTSW 7 43311092 missense probably damaging 0.99
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5007:Zfp715 UTSW 7 43299595 missense possibly damaging 0.53
R5477:Zfp715 UTSW 7 43299954 missense probably damaging 0.99
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R6538:Zfp715 UTSW 7 43299149 missense possibly damaging 0.73
R7322:Zfp715 UTSW 7 43311138 missense possibly damaging 0.53
R7629:Zfp715 UTSW 7 43301676 missense possibly damaging 0.92
R7934:Zfp715 UTSW 7 43299884 nonsense probably null
R7973:Zfp715 UTSW 7 43299897 missense possibly damaging 0.64
R8327:Zfp715 UTSW 7 43298058 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GAAGGCTTTTCCACACAGAGTAC -3'
(R):5'- CAGTCAACTCCTTATACCAGGC -3'

Sequencing Primer
(F):5'- CTCACAGCTGCTACACTTGTAAGG -3'
(R):5'- AGGCTCCTGTAATGCTAACTG -3'
Posted On2014-08-01