Incidental Mutation 'R1943:Olfr169'
ID216400
Institutional Source Beutler Lab
Gene Symbol Olfr169
Ensembl Gene ENSMUSG00000068535
Gene Nameolfactory receptor 169
SynonymsGA_x54KRFPKG5P-16014972-16014031, MOR273-3P
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1943 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19564889-19571809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19566437 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 149 (W149R)
Ref Sequence ENSEMBL: ENSMUSP00000150528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090062] [ENSMUST00000215040] [ENSMUST00000215476] [ENSMUST00000216070]
Predicted Effect probably benign
Transcript: ENSMUST00000090062
AA Change: W149R

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087516
Gene: ENSMUSG00000068535
AA Change: W149R

DomainStartEndE-ValueType
Pfam:7tm_4 28 308 1.3e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2e-6 PFAM
Pfam:7tm_1 41 290 7.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215040
AA Change: W149R

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000215476
AA Change: W149R

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000216070
AA Change: W149R

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Fh1 C T 1: 175,609,778 V252I probably benign Het
Gm13199 C T 2: 5,862,706 probably benign Het
Il1rn T C 2: 24,348,599 S82P possibly damaging Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Parp14 A G 16: 35,836,129 Y1676H probably damaging Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Rsph6a A C 7: 19,074,076 Y388S probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Sf3a3 A G 4: 124,715,901 K97E possibly damaging Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Slc7a10 T A 7: 35,200,298 V435E probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem2 G A 19: 21,848,040 probably null Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Zfp715 A T 7: 43,299,630 V302E possibly damaging Het
Other mutations in Olfr169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Olfr169 APN 16 19566208 missense probably damaging 1.00
IGL01862:Olfr169 APN 16 19566676 missense probably damaging 1.00
IGL02064:Olfr169 APN 16 19566548 missense probably damaging 1.00
IGL03061:Olfr169 APN 16 19566713 missense possibly damaging 0.87
IGL03136:Olfr169 APN 16 19566353 missense probably damaging 1.00
R0066:Olfr169 UTSW 16 19566049 missense probably damaging 1.00
R0243:Olfr169 UTSW 16 19566294 missense probably damaging 0.97
R0629:Olfr169 UTSW 16 19565980 missense possibly damaging 0.88
R1644:Olfr169 UTSW 16 19566406 missense probably benign 0.11
R3016:Olfr169 UTSW 16 19566391 missense probably damaging 1.00
R4290:Olfr169 UTSW 16 19566244 missense possibly damaging 0.88
R4689:Olfr169 UTSW 16 19566513 nonsense probably null
R4791:Olfr169 UTSW 16 19566663 missense possibly damaging 0.50
R5497:Olfr169 UTSW 16 19566330 missense probably benign 0.10
R5843:Olfr169 UTSW 16 19566583 missense probably damaging 1.00
R6106:Olfr169 UTSW 16 19566259 missense probably damaging 0.99
R6249:Olfr169 UTSW 16 19565975 missense probably damaging 0.99
R7895:Olfr169 UTSW 16 19566722 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCCTGATGACTGCATTTGG -3'
(R):5'- AACTATTTCCTTTGCAGGCTGTG -3'

Sequencing Primer
(F):5'- CCCTGATGACTGCATTTGGAATACAG -3'
(R):5'- GGCTGTGCCTTCCAGATATTTC -3'
Posted On2014-08-01