Incidental Mutation 'R0131:Kmt2b'
ID 21643
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Name lysine (K)-specific methyltransferase 2B
Synonyms 2610014H22Rik, Mll2, Wbp7
MMRRC Submission 038416-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0131 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 30268283-30288151 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30283346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 296 (C296S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000006470
AA Change: C1005S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: C1005S

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108154
AA Change: C1005S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: C1005S

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125836
Predicted Effect probably damaging
Transcript: ENSMUST00000131002
AA Change: C296S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: C296S

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Meta Mutation Damage Score 0.7389 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 90.2%
  • 20x: 71.5%
Validation Efficiency 87% (52/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,833,115 (GRCm39) Q1195L possibly damaging Het
Abcc12 A G 8: 87,258,197 (GRCm39) I773T probably benign Het
Adamtsl1 T A 4: 86,260,960 (GRCm39) I1057N possibly damaging Het
Adgrv1 A T 13: 81,651,114 (GRCm39) probably benign Het
Anxa5 G A 3: 36,504,821 (GRCm39) A247V probably damaging Het
Ascc3 T G 10: 50,611,425 (GRCm39) W1589G probably damaging Het
Atp2b2 G A 6: 113,770,743 (GRCm39) P389S probably damaging Het
Bicd1 A G 6: 149,414,445 (GRCm39) E386G probably damaging Het
Bmal2 C A 6: 146,729,601 (GRCm39) H471N probably benign Het
Bpifa6 T A 2: 153,824,851 (GRCm39) S9T probably benign Het
Cacna1c T C 6: 118,602,473 (GRCm39) I1428V probably damaging Het
Cfhr4 T A 1: 139,682,009 (GRCm39) T196S probably damaging Het
Chd8 A G 14: 52,442,783 (GRCm39) V589A probably benign Het
Chrnb2 T C 3: 89,671,713 (GRCm39) M1V probably null Het
Cldnd1 T C 16: 58,553,355 (GRCm39) L232P probably damaging Het
Col16a1 T A 4: 129,960,889 (GRCm39) V449E unknown Het
Col3a1 T A 1: 45,368,028 (GRCm39) probably benign Het
Cttnbp2nl T G 3: 104,913,173 (GRCm39) K237T probably damaging Het
Cyc1 G A 15: 76,229,159 (GRCm39) V142I probably benign Het
Dapk3 A G 10: 81,028,141 (GRCm39) T265A probably benign Het
Ddx21 A T 10: 62,420,531 (GRCm39) M711K possibly damaging Het
Dlg5 A T 14: 24,188,717 (GRCm39) L1735Q probably damaging Het
Dse A G 10: 34,029,660 (GRCm39) Y341H probably damaging Het
Elmod2 A G 8: 84,046,133 (GRCm39) I148T probably damaging Het
Fam187b T A 7: 30,688,545 (GRCm39) V22E probably damaging Het
Faxc A G 4: 21,936,659 (GRCm39) D98G probably damaging Het
Fcgbpl1 A G 7: 27,837,040 (GRCm39) R320G probably damaging Het
Fcrl2 A G 3: 87,166,266 (GRCm39) S170P possibly damaging Het
Fsip2 G A 2: 82,821,465 (GRCm39) D5733N probably benign Het
Gbe1 T C 16: 70,157,740 (GRCm39) probably benign Het
Gm6327 T C 16: 12,578,909 (GRCm39) noncoding transcript Het
H2-T24 T A 17: 36,325,878 (GRCm39) I238F probably damaging Het
Hectd4 A G 5: 121,471,087 (GRCm39) E2658G probably benign Het
Herc1 A C 9: 66,388,192 (GRCm39) I3826L probably benign Het
Hinfp A G 9: 44,211,060 (GRCm39) C67R probably damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Hspg2 T C 4: 137,279,198 (GRCm39) Y3094H probably damaging Het
Htr1f A G 16: 64,747,091 (GRCm39) V67A probably damaging Het
Idi2l T A 13: 8,990,563 (GRCm39) probably benign Het
Iqcc T G 4: 129,510,392 (GRCm39) E374D probably damaging Het
Kcnj9 T C 1: 172,153,765 (GRCm39) T120A probably damaging Het
Kitl C T 10: 99,923,226 (GRCm39) P208S probably benign Het
Lgals4 A G 7: 28,533,657 (GRCm39) probably null Het
Lpcat4 A G 2: 112,077,093 (GRCm39) Y479C probably damaging Het
Lrrc74b T C 16: 17,371,016 (GRCm39) N227S probably damaging Het
Mdc1 T A 17: 36,163,473 (GRCm39) V1007D probably damaging Het
Mocos T G 18: 24,812,819 (GRCm39) I571S probably benign Het
Myh8 A G 11: 67,183,014 (GRCm39) N659D probably damaging Het
Mylk T C 16: 34,695,874 (GRCm39) V203A probably benign Het
Myom2 A G 8: 15,133,329 (GRCm39) N407S probably damaging Het
Naip2 A G 13: 100,320,296 (GRCm39) V240A probably benign Het
Nap1l1 T C 10: 111,321,370 (GRCm39) S37P probably benign Het
Nin T G 12: 70,097,915 (GRCm39) K515T probably damaging Het
Npl T A 1: 153,384,864 (GRCm39) K258* probably null Het
Ntn4 T A 10: 93,480,569 (GRCm39) S98T possibly damaging Het
Or10x1 T C 1: 174,197,152 (GRCm39) V223A probably damaging Het
Or2t6 T C 14: 14,175,620 (GRCm38) D154G probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5k14 C A 16: 58,693,269 (GRCm39) M81I probably benign Het
Or8u10 T C 2: 85,915,844 (GRCm39) I92M probably damaging Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Pate3 A G 9: 35,557,453 (GRCm39) C68R probably damaging Het
Pcdh15 A G 10: 74,006,440 (GRCm39) D106G probably null Het
Ppox C A 1: 171,106,849 (GRCm39) A192S possibly damaging Het
Prkdc T C 16: 15,531,517 (GRCm39) L1380S probably benign Het
Proc C T 18: 32,268,951 (GRCm39) M11I probably benign Het
Psd4 C A 2: 24,295,363 (GRCm39) A839E probably damaging Het
Psg21 A G 7: 18,388,793 (GRCm39) Y100H probably benign Het
Pten T A 19: 32,753,469 (GRCm39) V45E probably benign Het
Ptprn2 T G 12: 116,685,711 (GRCm39) F57V probably damaging Het
Ptprt C T 2: 162,120,030 (GRCm39) V146I probably benign Het
R3hdm2 T A 10: 127,334,322 (GRCm39) M915K probably damaging Het
Rab26 C T 17: 24,749,759 (GRCm39) probably null Het
Rab7b T C 1: 131,626,293 (GRCm39) L107P probably damaging Het
Rbm47 T A 5: 66,183,872 (GRCm39) T244S possibly damaging Het
Rhbdf2 C A 11: 116,496,170 (GRCm39) G122C probably damaging Het
Rnf213 A G 11: 119,321,187 (GRCm39) E1215G probably benign Het
Rprd2 T C 3: 95,681,673 (GRCm39) K407E probably damaging Het
Siah3 G A 14: 75,693,574 (GRCm39) V27I possibly damaging Het
Slc12a3 G A 8: 95,067,511 (GRCm39) probably benign Het
Slc14a2 T A 18: 78,235,338 (GRCm39) N280Y probably damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc25a35 A G 11: 68,862,786 (GRCm39) Y247C probably damaging Het
Slc29a4 A G 5: 142,691,285 (GRCm39) D55G probably benign Het
Slc35d1 C T 4: 103,065,378 (GRCm39) V189I probably benign Het
Spg11 T C 2: 121,901,449 (GRCm39) E1497G probably damaging Het
Srrm1 G A 4: 135,067,884 (GRCm39) R322* probably null Het
Stac3 A T 10: 127,339,519 (GRCm39) R138S probably damaging Het
Tet3 C G 6: 83,345,770 (GRCm39) G1556R probably damaging Het
Tgfbr3 A G 5: 107,280,682 (GRCm39) S693P probably benign Het
Tmcc2 C T 1: 132,308,444 (GRCm39) G150D probably benign Het
Tmem216 T C 19: 10,531,970 (GRCm39) Y44C probably damaging Het
Tmem260 T A 14: 48,720,779 (GRCm39) C306* probably null Het
Tspyl1 A G 10: 34,159,085 (GRCm39) N270S probably damaging Het
Ubr4 A G 4: 139,191,362 (GRCm39) T4127A possibly damaging Het
Ugt2a2 T A 5: 87,622,720 (GRCm39) K293* probably null Het
Vmn2r102 A C 17: 19,899,025 (GRCm39) T456P probably benign Het
Vmn2r90 T A 17: 17,932,511 (GRCm39) S139R probably benign Het
Wrnip1 G A 13: 32,990,847 (GRCm39) V369I probably damaging Het
Zc3h12c T A 9: 52,037,923 (GRCm39) I305F possibly damaging Het
Zmym2 A G 14: 57,180,715 (GRCm39) N876D probably benign Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30,285,938 (GRCm39) unclassified probably benign
IGL00821:Kmt2b APN 7 30,270,038 (GRCm39) missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30,279,352 (GRCm39) missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30,279,932 (GRCm39) missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30,268,939 (GRCm39) critical splice donor site probably null
IGL01949:Kmt2b APN 7 30,276,586 (GRCm39) splice site probably null
IGL02253:Kmt2b APN 7 30,281,152 (GRCm39) missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30,278,303 (GRCm39) critical splice donor site probably null
IGL02493:Kmt2b APN 7 30,268,936 (GRCm39) unclassified probably benign
IGL02504:Kmt2b APN 7 30,285,968 (GRCm39) unclassified probably benign
IGL02532:Kmt2b APN 7 30,286,314 (GRCm39) unclassified probably benign
IGL02698:Kmt2b APN 7 30,278,118 (GRCm39) splice site probably benign
IGL02717:Kmt2b APN 7 30,282,869 (GRCm39) missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30,276,569 (GRCm39) missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30,274,887 (GRCm39) missense probably benign 0.02
IGL03386:Kmt2b APN 7 30,273,396 (GRCm39) missense possibly damaging 0.94
Dean UTSW 7 30,268,835 (GRCm39) missense possibly damaging 0.83
provost UTSW 7 30,281,633 (GRCm39) missense probably damaging 1.00
tenure UTSW 7 30,268,600 (GRCm39) missense probably damaging 1.00
3-1:Kmt2b UTSW 7 30,269,040 (GRCm39) nonsense probably null
FR4304:Kmt2b UTSW 7 30,285,788 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,800 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,794 (GRCm39) unclassified probably benign
FR4340:Kmt2b UTSW 7 30,285,788 (GRCm39) unclassified probably benign
FR4342:Kmt2b UTSW 7 30,285,800 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,794 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4449:Kmt2b UTSW 7 30,285,786 (GRCm39) unclassified probably benign
FR4548:Kmt2b UTSW 7 30,285,805 (GRCm39) unclassified probably benign
FR4589:Kmt2b UTSW 7 30,285,806 (GRCm39) unclassified probably benign
FR4589:Kmt2b UTSW 7 30,285,789 (GRCm39) nonsense probably null
FR4589:Kmt2b UTSW 7 30,285,786 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,795 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,792 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4737:Kmt2b UTSW 7 30,285,803 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,787 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,785 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,798 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,791 (GRCm39) unclassified probably benign
FR4976:Kmt2b UTSW 7 30,285,789 (GRCm39) nonsense probably null
PIT4403001:Kmt2b UTSW 7 30,285,114 (GRCm39) missense probably damaging 1.00
PIT4802001:Kmt2b UTSW 7 30,278,996 (GRCm39) missense probably damaging 0.99
R0057:Kmt2b UTSW 7 30,276,217 (GRCm39) splice site probably benign
R0241:Kmt2b UTSW 7 30,276,494 (GRCm39) missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30,276,494 (GRCm39) missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30,273,618 (GRCm39) missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30,276,180 (GRCm39) missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30,274,365 (GRCm39) missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30,279,912 (GRCm39) missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30,276,385 (GRCm39) splice site probably benign
R1599:Kmt2b UTSW 7 30,270,000 (GRCm39) missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30,283,387 (GRCm39) missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30,285,275 (GRCm39) missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30,274,083 (GRCm39) missense possibly damaging 0.71
R1955:Kmt2b UTSW 7 30,274,776 (GRCm39) missense possibly damaging 0.90
R2040:Kmt2b UTSW 7 30,268,845 (GRCm39) missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30,282,812 (GRCm39) missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30,273,490 (GRCm39) missense probably benign 0.25
R2401:Kmt2b UTSW 7 30,276,133 (GRCm39) missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30,275,493 (GRCm39) missense probably benign 0.10
R3436:Kmt2b UTSW 7 30,276,117 (GRCm39) missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30,273,489 (GRCm39) missense probably benign 0.25
R4259:Kmt2b UTSW 7 30,280,506 (GRCm39) missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30,281,261 (GRCm39) critical splice donor site probably null
R4388:Kmt2b UTSW 7 30,288,015 (GRCm39) unclassified probably benign
R4542:Kmt2b UTSW 7 30,279,684 (GRCm39) missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30,285,783 (GRCm39) unclassified probably benign
R4722:Kmt2b UTSW 7 30,282,627 (GRCm39) missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30,276,186 (GRCm39) nonsense probably null
R4916:Kmt2b UTSW 7 30,277,942 (GRCm39) missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30,269,265 (GRCm39) missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30,268,600 (GRCm39) missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30,269,219 (GRCm39) missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30,281,098 (GRCm39) missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30,279,869 (GRCm39) missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30,276,570 (GRCm39) missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30,287,902 (GRCm39) unclassified probably benign
R6727:Kmt2b UTSW 7 30,283,984 (GRCm39) missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30,285,701 (GRCm39) unclassified probably benign
R7048:Kmt2b UTSW 7 30,268,731 (GRCm39) missense probably damaging 0.99
R7155:Kmt2b UTSW 7 30,279,388 (GRCm39) missense probably damaging 0.99
R7307:Kmt2b UTSW 7 30,279,896 (GRCm39) missense probably damaging 0.99
R7388:Kmt2b UTSW 7 30,281,385 (GRCm39) missense probably damaging 1.00
R7555:Kmt2b UTSW 7 30,268,835 (GRCm39) missense possibly damaging 0.83
R7569:Kmt2b UTSW 7 30,268,978 (GRCm39) missense possibly damaging 0.54
R7616:Kmt2b UTSW 7 30,281,633 (GRCm39) missense probably damaging 1.00
R7669:Kmt2b UTSW 7 30,282,656 (GRCm39) missense possibly damaging 0.84
R7881:Kmt2b UTSW 7 30,279,208 (GRCm39) missense probably damaging 1.00
R7999:Kmt2b UTSW 7 30,276,199 (GRCm39) missense probably damaging 1.00
R8003:Kmt2b UTSW 7 30,268,802 (GRCm39) missense probably damaging 0.98
R8189:Kmt2b UTSW 7 30,268,756 (GRCm39) missense probably damaging 0.98
R8291:Kmt2b UTSW 7 30,284,894 (GRCm39) missense probably damaging 1.00
R8314:Kmt2b UTSW 7 30,278,347 (GRCm39) missense probably damaging 0.99
R8802:Kmt2b UTSW 7 30,283,496 (GRCm39) missense probably damaging 1.00
R8954:Kmt2b UTSW 7 30,273,640 (GRCm39) missense probably damaging 1.00
R9046:Kmt2b UTSW 7 30,285,479 (GRCm39) missense probably benign 0.00
R9225:Kmt2b UTSW 7 30,286,172 (GRCm39) missense unknown
R9258:Kmt2b UTSW 7 30,281,893 (GRCm39) missense probably null 0.99
R9414:Kmt2b UTSW 7 30,282,307 (GRCm39) missense probably damaging 0.99
R9468:Kmt2b UTSW 7 30,284,513 (GRCm39) missense probably damaging 0.98
R9508:Kmt2b UTSW 7 30,269,259 (GRCm39) missense probably damaging 0.99
R9642:Kmt2b UTSW 7 30,283,340 (GRCm39) critical splice donor site probably null
R9667:Kmt2b UTSW 7 30,287,784 (GRCm39) missense unknown
R9709:Kmt2b UTSW 7 30,279,228 (GRCm39) missense probably damaging 0.98
RF001:Kmt2b UTSW 7 30,285,807 (GRCm39) unclassified probably benign
RF006:Kmt2b UTSW 7 30,285,802 (GRCm39) unclassified probably benign
RF020:Kmt2b UTSW 7 30,285,807 (GRCm39) unclassified probably benign
RF021:Kmt2b UTSW 7 30,285,782 (GRCm39) unclassified probably benign
RF030:Kmt2b UTSW 7 30,285,802 (GRCm39) unclassified probably benign
RF035:Kmt2b UTSW 7 30,285,782 (GRCm39) unclassified probably benign
X0067:Kmt2b UTSW 7 30,278,998 (GRCm39) missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30,284,676 (GRCm39) missense probably benign 0.28
Z1176:Kmt2b UTSW 7 30,276,795 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2b UTSW 7 30,285,841 (GRCm39) missense unknown
Z1177:Kmt2b UTSW 7 30,283,588 (GRCm39) missense probably damaging 0.98
Z1177:Kmt2b UTSW 7 30,274,449 (GRCm39) missense probably benign 0.08
Z1186:Kmt2b UTSW 7 30,284,732 (GRCm39) missense probably benign
Z1186:Kmt2b UTSW 7 30,274,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTGAAGAAACCCTCTCCAAGCC -3'
(R):5'- AGCATCAGAGACTGAGAGTGTCCC -3'

Sequencing Primer
(F):5'- TGTCACACTTCCGGTATCTG -3'
(R):5'- AGACTGAGAGTGTCCCTTCCC -3'
Posted On 2013-04-11