Incidental Mutation 'R1944:Miip'
ID 216434
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission 039962-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R1944 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 147945235-147953176 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 147950422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 58 (E58G)
Ref Sequence ENSEMBL: ENSMUSP00000134085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000094481] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably benign
Transcript: ENSMUST00000030886
AA Change: E58G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: E58G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094481
SMART Domains Protein: ENSMUSP00000092054
Gene: ENSMUSG00000070583

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
coiled coil region 86 116 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119975
AA Change: E58G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: E58G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156374
Predicted Effect probably benign
Transcript: ENSMUST00000172710
AA Change: E58G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: E58G

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173034
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,980,796 (GRCm39) N593Y probably damaging Het
Adamts16 C T 13: 70,940,005 (GRCm39) S406N possibly damaging Het
Adgrg1 G A 8: 95,733,928 (GRCm39) V350I probably damaging Het
Adgrv1 A T 13: 81,659,030 (GRCm39) D2051E probably damaging Het
Adrb2 C A 18: 62,312,484 (GRCm39) V114L probably damaging Het
Ago3 A G 4: 126,247,520 (GRCm39) V599A probably damaging Het
AI837181 T C 19: 5,476,257 (GRCm39) V140A probably damaging Het
Ankrd16 T A 2: 11,788,443 (GRCm39) probably null Het
Arnt2 A G 7: 83,992,959 (GRCm39) S194P probably benign Het
Art2b T C 7: 101,229,153 (GRCm39) N249D probably benign Het
Atat1 A G 17: 36,220,232 (GRCm39) L60P probably damaging Het
Atp2b1 A T 10: 98,858,793 (GRCm39) I1159F probably damaging Het
Atrip T A 9: 108,900,935 (GRCm39) I135F probably damaging Het
Bbs4 T G 9: 59,237,698 (GRCm39) probably null Het
Bdp1 A T 13: 100,210,889 (GRCm39) probably null Het
Best2 A G 8: 85,737,390 (GRCm39) probably null Het
Cacna1c A G 6: 118,583,227 (GRCm39) I1516T probably damaging Het
Cadps2 T C 6: 23,599,479 (GRCm39) I276V probably damaging Het
Carmil3 T C 14: 55,736,087 (GRCm39) S610P probably damaging Het
Caskin1 A G 17: 24,719,745 (GRCm39) I375V probably damaging Het
Ccdc168 G A 1: 44,101,009 (GRCm39) P30S probably damaging Het
Ccdc92b A G 11: 74,520,835 (GRCm39) I46V probably benign Het
Clec11a G T 7: 43,954,098 (GRCm39) T285K probably benign Het
Clk3 G T 9: 57,672,469 (GRCm39) T111K probably benign Het
Col6a6 G A 9: 105,586,583 (GRCm39) R1813C probably damaging Het
Col7a1 G A 9: 108,789,078 (GRCm39) V798I unknown Het
Ctrb1 C A 8: 112,416,151 (GRCm39) W45L probably damaging Het
Cubn T A 2: 13,283,349 (GRCm39) S3530C probably benign Het
Dio1 A G 4: 107,163,977 (GRCm39) probably null Het
Dock5 A T 14: 67,994,584 (GRCm39) Y1825* probably null Het
Duox1 A T 2: 122,177,001 (GRCm39) Q1476L probably damaging Het
Dync2h1 A T 9: 7,001,377 (GRCm39) H3877Q probably damaging Het
Enkd1 A G 8: 106,434,208 (GRCm39) S85P probably damaging Het
Erap1 A G 13: 74,794,758 (GRCm39) D139G probably benign Het
Ern1 A G 11: 106,312,776 (GRCm39) S202P probably damaging Het
F11r T C 1: 171,289,459 (GRCm39) Y261H probably damaging Het
Glp2r A T 11: 67,637,618 (GRCm39) S138T probably benign Het
Gpt2 A G 8: 86,244,625 (GRCm39) Y306C probably damaging Het
Grid2 G C 6: 63,886,045 (GRCm39) R147P probably damaging Het
Gtdc1 A G 2: 44,642,198 (GRCm39) F128L possibly damaging Het
H2-T15 A G 17: 36,368,897 (GRCm39) F61S probably damaging Het
Hacd4 T C 4: 88,341,303 (GRCm39) T154A possibly damaging Het
Heatr6 G T 11: 83,660,046 (GRCm39) L530F probably damaging Het
Hoxd8 A T 2: 74,537,056 (GRCm39) D256V probably damaging Het
Ints6 T C 14: 62,931,089 (GRCm39) N865D probably benign Het
Itpkc G T 7: 26,927,084 (GRCm39) P277T possibly damaging Het
Klc4 T C 17: 46,947,553 (GRCm39) N383S probably damaging Het
Klra6 T C 6: 129,995,908 (GRCm39) Y150C possibly damaging Het
Krt32 T A 11: 99,975,670 (GRCm39) probably null Het
Krt33a T C 11: 99,903,535 (GRCm39) N199S probably benign Het
Krt39 A C 11: 99,410,649 (GRCm39) D174E probably damaging Het
Krt82 G A 15: 101,456,970 (GRCm39) R137W probably damaging Het
Lgmn A T 12: 102,368,183 (GRCm39) S193T probably damaging Het
Limch1 G A 5: 67,156,442 (GRCm39) R300H probably damaging Het
Lrpap1 T A 5: 35,254,974 (GRCm39) I221F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Macf1 T C 4: 123,264,459 (GRCm39) D4883G probably damaging Het
Man2b2 A G 5: 36,973,524 (GRCm39) V485A probably benign Het
Map3k19 T C 1: 127,750,859 (GRCm39) T831A probably benign Het
Mdfic2 A G 6: 98,225,151 (GRCm39) I44T probably benign Het
Megf6 C G 4: 154,340,523 (GRCm39) D471E possibly damaging Het
Mettl8 A T 2: 70,803,623 (GRCm39) F268L probably damaging Het
Mycbp2 T A 14: 103,466,840 (GRCm39) S1308C probably damaging Het
Myo15a T C 11: 60,392,909 (GRCm39) F2194L probably damaging Het
Nav3 T C 10: 109,552,391 (GRCm39) N1817S probably damaging Het
Ndel1 A T 11: 68,720,746 (GRCm39) H313Q probably benign Het
Neb A T 2: 52,118,862 (GRCm39) H3931Q probably benign Het
Nfkb2 T A 19: 46,296,491 (GRCm39) V253E probably damaging Het
Niban1 T C 1: 151,571,979 (GRCm39) I308T probably damaging Het
Nono T C X: 100,485,429 (GRCm39) probably null Het
Npc1l1 T A 11: 6,164,588 (GRCm39) I1154F possibly damaging Het
Nr2e1 T C 10: 42,448,774 (GRCm39) T155A probably benign Het
Oosp2 C T 19: 11,626,959 (GRCm39) probably null Het
Or2b2 A T 13: 21,887,287 (GRCm39) I39F possibly damaging Het
Pdap1 G A 5: 145,069,726 (GRCm39) T93I probably benign Het
Pde6c T A 19: 38,145,967 (GRCm39) D418E probably damaging Het
Pdha1 T A X: 158,910,354 (GRCm39) D255V probably damaging Het
Polr2h T A 16: 20,537,796 (GRCm39) D64E probably benign Het
Psmb3 T C 11: 97,601,981 (GRCm39) F117S probably benign Het
Ptprq A T 10: 107,418,249 (GRCm39) M1709K probably benign Het
Rbm15 C T 3: 107,238,868 (GRCm39) R510H probably damaging Het
Rgs7 A T 1: 174,980,769 (GRCm39) M85K possibly damaging Het
Rpl27-ps3 T A 18: 6,332,669 (GRCm39) V13D probably damaging Het
Rtp2 T A 16: 23,746,316 (GRCm39) D105V possibly damaging Het
Scd3 T C 19: 44,224,219 (GRCm39) Y151H probably benign Het
Slc30a6 T G 17: 74,715,858 (GRCm39) V106G probably damaging Het
Slco1a4 T C 6: 141,785,276 (GRCm39) I105V probably benign Het
Sun3 T C 11: 8,988,296 (GRCm39) I9V probably benign Het
Syne2 T C 12: 76,121,318 (GRCm39) V5928A probably damaging Het
Tbr1 T A 2: 61,642,600 (GRCm39) S622T probably damaging Het
Tgm3 A G 2: 129,871,889 (GRCm39) N306D probably damaging Het
Tmem132d A G 5: 127,860,828 (GRCm39) *1098Q probably null Het
Tmem140 T C 6: 34,849,747 (GRCm39) Y88H probably damaging Het
Trim60 A T 8: 65,453,964 (GRCm39) V95E possibly damaging Het
Vamp3 A G 4: 151,140,617 (GRCm39) probably null Het
Vmn1r235 A C 17: 21,481,785 (GRCm39) T37P probably damaging Het
Vmn2r81 T G 10: 79,129,571 (GRCm39) L821V probably damaging Het
Vmn2r97 A G 17: 19,160,500 (GRCm39) D545G probably benign Het
Vps13c A T 9: 67,793,558 (GRCm39) D437V probably damaging Het
Wtip A T 7: 33,818,363 (GRCm39) M268K probably benign Het
Zfhx2 G T 14: 55,312,189 (GRCm39) F168L probably benign Het
Zscan22 G A 7: 12,637,767 (GRCm39) R53K probably damaging Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147,950,322 (GRCm39) missense probably damaging 1.00
IGL02134:Miip APN 4 147,949,735 (GRCm39) splice site probably benign
IGL02829:Miip APN 4 147,947,518 (GRCm39) missense probably benign 0.01
IGL03350:Miip APN 4 147,946,979 (GRCm39) missense probably benign 0.01
R0200:Miip UTSW 4 147,946,720 (GRCm39) missense probably damaging 0.99
R1647:Miip UTSW 4 147,949,691 (GRCm39) missense probably benign 0.02
R1783:Miip UTSW 4 147,950,231 (GRCm39) missense probably damaging 1.00
R1848:Miip UTSW 4 147,947,549 (GRCm39) missense probably damaging 0.99
R3615:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3616:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3882:Miip UTSW 4 147,945,509 (GRCm39) missense possibly damaging 0.93
R4579:Miip UTSW 4 147,945,518 (GRCm39) missense probably damaging 1.00
R5183:Miip UTSW 4 147,947,526 (GRCm39) missense probably damaging 1.00
R6054:Miip UTSW 4 147,950,135 (GRCm39) missense probably benign 0.00
R6056:Miip UTSW 4 147,946,792 (GRCm39) missense probably damaging 1.00
R6304:Miip UTSW 4 147,947,540 (GRCm39) missense probably benign 0.12
R6568:Miip UTSW 4 147,950,372 (GRCm39) missense probably benign
R6603:Miip UTSW 4 147,950,380 (GRCm39) missense possibly damaging 0.92
R7639:Miip UTSW 4 147,947,021 (GRCm39) missense probably benign 0.22
R7701:Miip UTSW 4 147,947,371 (GRCm39) missense probably null 0.86
R7795:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7796:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7797:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7872:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7920:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R8468:Miip UTSW 4 147,945,928 (GRCm39) missense probably damaging 1.00
R8492:Miip UTSW 4 147,945,881 (GRCm39) missense probably damaging 1.00
R8677:Miip UTSW 4 147,947,503 (GRCm39) missense probably damaging 1.00
R8852:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R8860:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R9755:Miip UTSW 4 147,950,319 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGACCCTGAGTGGCTAG -3'
(R):5'- CAAAACTGAGGCCTTGGGAG -3'

Sequencing Primer
(F):5'- CCTGAGTGGCTAGCAAGGGTAC -3'
(R):5'- CCTTGGGAGGAAGGGACTG -3'
Posted On 2014-08-01