Mutagenetix > Incidental Mutation

Incidental Mutation 'R1944:Cadps2'

216446

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

039962-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1944 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23599480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 276 (I276V)

Ref Sequence

ENSEMBL: ENSMUSP00000128905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018122
AA Change: I276V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: I276V

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069074
AA Change: I276V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: I276V

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115356
AA Change: I276V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: I276V

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115358
AA Change: I276V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: I276V

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115361
AA Change: I276V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: I276V

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136279

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142913
AA Change: I247V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: I247V

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163871
AA Change: I276V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: I276V

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166458
AA Change: I247V

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: I247V

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	T	5: 8,930,796	N593Y	probably damaging	Het
Adamts16	C	T	13: 70,791,886	S406N	possibly damaging	Het
Adgrg1	G	A	8: 95,007,300	V350I	probably damaging	Het
Adgrv1	A	T	13: 81,510,911	D2051E	probably damaging	Het
Adrb2	C	A	18: 62,179,413	V114L	probably damaging	Het
Ago3	A	G	4: 126,353,727	V599A	probably damaging	Het
AI837181	T	C	19: 5,426,229	V140A	probably damaging	Het
Ankrd16	T	A	2: 11,783,632		probably null	Het
Arnt2	A	G	7: 84,343,751	S194P	probably benign	Het
Art2b	T	C	7: 101,579,946	N249D	probably benign	Het
Atat1	A	G	17: 35,909,340	L60P	probably damaging	Het
Atp2b1	A	T	10: 99,022,931	I1159F	probably damaging	Het
Atrip	T	A	9: 109,071,867	I135F	probably damaging	Het
Bbs4	T	G	9: 59,330,415		probably null	Het
Bdp1	A	T	13: 100,074,381		probably null	Het
Best2	A	G	8: 85,010,761		probably null	Het
Cacna1c	A	G	6: 118,606,266	I1516T	probably damaging	Het
Carmil3	T	C	14: 55,498,630	S610P	probably damaging	Het
Caskin1	A	G	17: 24,500,771	I375V	probably damaging	Het
Ccdc92b	A	G	11: 74,630,009	I46V	probably benign	Het
Clec11a	G	T	7: 44,304,674	T285K	probably benign	Het
Clk3	G	T	9: 57,765,186	T111K	probably benign	Het
Col6a6	G	A	9: 105,709,384	R1813C	probably damaging	Het
Col7a1	G	A	9: 108,960,010	V798I	unknown	Het
Ctrb1	C	A	8: 111,689,519	W45L	probably damaging	Het
Cubn	T	A	2: 13,278,538	S3530C	probably benign	Het
Dio1	A	G	4: 107,306,780		probably null	Het
Dock5	A	T	14: 67,757,135	Y1825*	probably null	Het
Duox1	A	T	2: 122,346,520	Q1476L	probably damaging	Het
Dync2h1	A	T	9: 7,001,377	H3877Q	probably damaging	Het
Enkd1	A	G	8: 105,707,576	S85P	probably damaging	Het
Erap1	A	G	13: 74,646,639	D139G	probably benign	Het
Ern1	A	G	11: 106,421,950	S202P	probably damaging	Het
F11r	T	C	1: 171,461,891	Y261H	probably damaging	Het
Fam129a	T	C	1: 151,696,228	I308T	probably damaging	Het
Glp2r	A	T	11: 67,746,792	S138T	probably benign	Het
Gm11127	A	G	17: 36,058,005	F61S	probably damaging	Het
Gm765	A	G	6: 98,248,190	I44T	probably benign	Het
Gm8251	G	A	1: 44,061,849	P30S	probably damaging	Het
Gpt2	A	G	8: 85,517,996	Y306C	probably damaging	Het
Grid2	G	C	6: 63,909,061	R147P	probably damaging	Het
Gtdc1	A	G	2: 44,752,186	F128L	possibly damaging	Het
Hacd4	T	C	4: 88,423,066	T154A	possibly damaging	Het
Heatr6	G	T	11: 83,769,220	L530F	probably damaging	Het
Hoxd8	A	T	2: 74,706,712	D256V	probably damaging	Het
Ints6	T	C	14: 62,693,640	N865D	probably benign	Het
Itpkc	G	T	7: 27,227,659	P277T	possibly damaging	Het
Klc4	T	C	17: 46,636,627	N383S	probably damaging	Het
Klra6	T	C	6: 130,018,945	Y150C	possibly damaging	Het
Krt32	T	A	11: 100,084,844		probably null	Het
Krt33a	T	C	11: 100,012,709	N199S	probably benign	Het
Krt39	A	C	11: 99,519,823	D174E	probably damaging	Het
Krt82	G	A	15: 101,548,535	R137W	probably damaging	Het
Lgmn	A	T	12: 102,401,924	S193T	probably damaging	Het
Limch1	G	A	5: 66,999,099	R300H	probably damaging	Het
Lrpap1	T	A	5: 35,097,630	I221F	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Macf1	T	C	4: 123,370,666	D4883G	probably damaging	Het
Man2b2	A	G	5: 36,816,180	V485A	probably benign	Het
Map3k19	T	C	1: 127,823,122	T831A	probably benign	Het
Megf6	C	G	4: 154,256,066	D471E	possibly damaging	Het
Mettl8	A	T	2: 70,973,279	F268L	probably damaging	Het
Miip	T	C	4: 147,865,965	E58G	probably benign	Het
Mycbp2	T	A	14: 103,229,404	S1308C	probably damaging	Het
Myo15	T	C	11: 60,502,083	F2194L	probably damaging	Het
Nav3	T	C	10: 109,716,530	N1817S	probably damaging	Het
Ndel1	A	T	11: 68,829,920	H313Q	probably benign	Het
Neb	A	T	2: 52,228,850	H3931Q	probably benign	Het
Nfkb2	T	A	19: 46,308,052	V253E	probably damaging	Het
Nono	T	C	X: 101,441,823		probably null	Het
Npc1l1	T	A	11: 6,214,588	I1154F	possibly damaging	Het
Nr2e1	T	C	10: 42,572,778	T155A	probably benign	Het
Olfr1359	A	T	13: 21,703,117	I39F	possibly damaging	Het
Oosp2	C	T	19: 11,649,595		probably null	Het
Pdap1	G	A	5: 145,132,916	T93I	probably benign	Het
Pde6c	T	A	19: 38,157,519	D418E	probably damaging	Het
Pdha1	T	A	X: 160,127,358	D255V	probably damaging	Het
Polr2h	T	A	16: 20,719,046	D64E	probably benign	Het
Psmb3	T	C	11: 97,711,155	F117S	probably benign	Het
Ptprq	A	T	10: 107,582,388	M1709K	probably benign	Het
Rbm15	C	T	3: 107,331,552	R510H	probably damaging	Het
Rgs7	A	T	1: 175,153,203	M85K	possibly damaging	Het
Rpl27-ps3	T	A	18: 6,332,669	V13D	probably damaging	Het
Rtp2	T	A	16: 23,927,566	D105V	possibly damaging	Het
Scd3	T	C	19: 44,235,780	Y151H	probably benign	Het
Slc30a6	T	G	17: 74,408,863	V106G	probably damaging	Het
Slco1a4	T	C	6: 141,839,550	I105V	probably benign	Het
Sun3	T	C	11: 9,038,296	I9V	probably benign	Het
Syne2	T	C	12: 76,074,544	V5928A	probably damaging	Het
Tbr1	T	A	2: 61,812,256	S622T	probably damaging	Het
Tgm3	A	G	2: 130,029,969	N306D	probably damaging	Het
Tmem132d	A	G	5: 127,783,764	*1098Q	probably null	Het
Tmem140	T	C	6: 34,872,812	Y88H	probably damaging	Het
Trim60	A	T	8: 65,001,312	V95E	possibly damaging	Het
Vamp3	A	G	4: 151,056,160		probably null	Het
Vmn1r235	A	C	17: 21,261,523	T37P	probably damaging	Het
Vmn2r81	T	G	10: 79,293,737	L821V	probably damaging	Het
Vmn2r97	A	G	17: 18,940,238	D545G	probably benign	Het
Vps13c	A	T	9: 67,886,276	D437V	probably damaging	Het
Wtip	A	T	7: 34,118,938	M268K	probably benign	Het
Zfhx2	G	T	14: 55,074,732	F168L	probably benign	Het
Zscan22	G	A	7: 12,903,840	R53K	probably damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTAGAGAGTGTCCTCCATTTAG -3'
(R):5'- ATTTGTTGCCAATGCGTCAG -3'

Sequencing Primer
(F):5'- AGTGTCCTCCATTTAGAAAATATGAG -3'
(R):5'- CGTCAGGCAGAGTTATTACAAC -3'

Posted On

2014-08-01