Mutagenetix > Incidental Mutations

Incidental Mutation 'R1944:Arnt2'

216458

Institutional Source

Beutler Lab

Gene Symbol

Arnt2

Ensembl Gene

ENSMUSG00000015709

Gene Name

aryl hydrocarbon receptor nuclear translocator 2

Synonyms

bHLHe1

MMRRC Submission

039962-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1944 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84246278-84410176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84343751 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 194 (S194P)

Ref Sequence

ENSEMBL: ENSMUSP00000147129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000207769] [ENSMUST00000208204] [ENSMUST00000208232] [ENSMUST00000208392] [ENSMUST00000208863] [ENSMUST00000208995] [ENSMUST00000209133]

Predicted Effect

probably benign
Transcript: ENSMUST00000085077
AA Change: S205P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: S205P

Domain	Start	End	E-Value	Type
HLH	69	122	1.42e-14	SMART
PAS	137	204	1.28e-8	SMART
low complexity region	225	236	N/A	INTRINSIC
PAS	325	391	4.15e-8	SMART
PAC	398	441	7.93e-5	SMART
low complexity region	502	526	N/A	INTRINSIC
low complexity region	597	626	N/A	INTRINSIC
low complexity region	653	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207512

Predicted Effect

probably benign
Transcript: ENSMUST00000207769

Predicted Effect

probably benign
Transcript: ENSMUST00000208204

Predicted Effect

probably benign
Transcript: ENSMUST00000208232
AA Change: S194P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000208392

Predicted Effect

probably benign
Transcript: ENSMUST00000208863

Predicted Effect

probably benign
Transcript: ENSMUST00000208995
AA Change: S194P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000209133
AA Change: S194P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	T	5: 8,930,796	N593Y	probably damaging	Het
Adamts16	C	T	13: 70,791,886	S406N	possibly damaging	Het
Adgrg1	G	A	8: 95,007,300	V350I	probably damaging	Het
Adgrv1	A	T	13: 81,510,911	D2051E	probably damaging	Het
Adrb2	C	A	18: 62,179,413	V114L	probably damaging	Het
Ago3	A	G	4: 126,353,727	V599A	probably damaging	Het
AI837181	T	C	19: 5,426,229	V140A	probably damaging	Het
Ankrd16	T	A	2: 11,783,632		probably null	Het
Art2b	T	C	7: 101,579,946	N249D	probably benign	Het
Atat1	A	G	17: 35,909,340	L60P	probably damaging	Het
Atp2b1	A	T	10: 99,022,931	I1159F	probably damaging	Het
Atrip	T	A	9: 109,071,867	I135F	probably damaging	Het
Bbs4	T	G	9: 59,330,415		probably null	Het
Bdp1	A	T	13: 100,074,381		probably null	Het
Best2	A	G	8: 85,010,761		probably null	Het
Cacna1c	A	G	6: 118,606,266	I1516T	probably damaging	Het
Cadps2	T	C	6: 23,599,480	I276V	probably damaging	Het
Carmil3	T	C	14: 55,498,630	S610P	probably damaging	Het
Caskin1	A	G	17: 24,500,771	I375V	probably damaging	Het
Ccdc92b	A	G	11: 74,630,009	I46V	probably benign	Het
Clec11a	G	T	7: 44,304,674	T285K	probably benign	Het
Clk3	G	T	9: 57,765,186	T111K	probably benign	Het
Col6a6	G	A	9: 105,709,384	R1813C	probably damaging	Het
Col7a1	G	A	9: 108,960,010	V798I	unknown	Het
Ctrb1	C	A	8: 111,689,519	W45L	probably damaging	Het
Cubn	T	A	2: 13,278,538	S3530C	probably benign	Het
Dio1	A	G	4: 107,306,780		probably null	Het
Dock5	A	T	14: 67,757,135	Y1825*	probably null	Het
Duox1	A	T	2: 122,346,520	Q1476L	probably damaging	Het
Dync2h1	A	T	9: 7,001,377	H3877Q	probably damaging	Het
Enkd1	A	G	8: 105,707,576	S85P	probably damaging	Het
Erap1	A	G	13: 74,646,639	D139G	probably benign	Het
Ern1	A	G	11: 106,421,950	S202P	probably damaging	Het
F11r	T	C	1: 171,461,891	Y261H	probably damaging	Het
Fam129a	T	C	1: 151,696,228	I308T	probably damaging	Het
Glp2r	A	T	11: 67,746,792	S138T	probably benign	Het
Gm11127	A	G	17: 36,058,005	F61S	probably damaging	Het
Gm765	A	G	6: 98,248,190	I44T	probably benign	Het
Gm8251	G	A	1: 44,061,849	P30S	probably damaging	Het
Gpt2	A	G	8: 85,517,996	Y306C	probably damaging	Het
Grid2	G	C	6: 63,909,061	R147P	probably damaging	Het
Gtdc1	A	G	2: 44,752,186	F128L	possibly damaging	Het
Hacd4	T	C	4: 88,423,066	T154A	possibly damaging	Het
Heatr6	G	T	11: 83,769,220	L530F	probably damaging	Het
Hoxd8	A	T	2: 74,706,712	D256V	probably damaging	Het
Ints6	T	C	14: 62,693,640	N865D	probably benign	Het
Itpkc	G	T	7: 27,227,659	P277T	possibly damaging	Het
Klc4	T	C	17: 46,636,627	N383S	probably damaging	Het
Klra6	T	C	6: 130,018,945	Y150C	possibly damaging	Het
Krt32	T	A	11: 100,084,844		probably null	Het
Krt33a	T	C	11: 100,012,709	N199S	probably benign	Het
Krt39	A	C	11: 99,519,823	D174E	probably damaging	Het
Krt82	G	A	15: 101,548,535	R137W	probably damaging	Het
Lgmn	A	T	12: 102,401,924	S193T	probably damaging	Het
Limch1	G	A	5: 66,999,099	R300H	probably damaging	Het
Lrpap1	T	A	5: 35,097,630	I221F	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Macf1	T	C	4: 123,370,666	D4883G	probably damaging	Het
Man2b2	A	G	5: 36,816,180	V485A	probably benign	Het
Map3k19	T	C	1: 127,823,122	T831A	probably benign	Het
Megf6	C	G	4: 154,256,066	D471E	possibly damaging	Het
Mettl8	A	T	2: 70,973,279	F268L	probably damaging	Het
Miip	T	C	4: 147,865,965	E58G	probably benign	Het
Mycbp2	T	A	14: 103,229,404	S1308C	probably damaging	Het
Myo15	T	C	11: 60,502,083	F2194L	probably damaging	Het
Nav3	T	C	10: 109,716,530	N1817S	probably damaging	Het
Ndel1	A	T	11: 68,829,920	H313Q	probably benign	Het
Neb	A	T	2: 52,228,850	H3931Q	probably benign	Het
Nfkb2	T	A	19: 46,308,052	V253E	probably damaging	Het
Nono	T	C	X: 101,441,823		probably null	Het
Npc1l1	T	A	11: 6,214,588	I1154F	possibly damaging	Het
Nr2e1	T	C	10: 42,572,778	T155A	probably benign	Het
Olfr1359	A	T	13: 21,703,117	I39F	possibly damaging	Het
Oosp2	C	T	19: 11,649,595		probably null	Het
Pdap1	G	A	5: 145,132,916	T93I	probably benign	Het
Pde6c	T	A	19: 38,157,519	D418E	probably damaging	Het
Pdha1	T	A	X: 160,127,358	D255V	probably damaging	Het
Polr2h	T	A	16: 20,719,046	D64E	probably benign	Het
Psmb3	T	C	11: 97,711,155	F117S	probably benign	Het
Ptprq	A	T	10: 107,582,388	M1709K	probably benign	Het
Rbm15	C	T	3: 107,331,552	R510H	probably damaging	Het
Rgs7	A	T	1: 175,153,203	M85K	possibly damaging	Het
Rpl27-ps3	T	A	18: 6,332,669	V13D	probably damaging	Het
Rtp2	T	A	16: 23,927,566	D105V	possibly damaging	Het
Scd3	T	C	19: 44,235,780	Y151H	probably benign	Het
Slc30a6	T	G	17: 74,408,863	V106G	probably damaging	Het
Slco1a4	T	C	6: 141,839,550	I105V	probably benign	Het
Sun3	T	C	11: 9,038,296	I9V	probably benign	Het
Syne2	T	C	12: 76,074,544	V5928A	probably damaging	Het
Tbr1	T	A	2: 61,812,256	S622T	probably damaging	Het
Tgm3	A	G	2: 130,029,969	N306D	probably damaging	Het
Tmem132d	A	G	5: 127,783,764	*1098Q	probably null	Het
Tmem140	T	C	6: 34,872,812	Y88H	probably damaging	Het
Trim60	A	T	8: 65,001,312	V95E	possibly damaging	Het
Vamp3	A	G	4: 151,056,160		probably null	Het
Vmn1r235	A	C	17: 21,261,523	T37P	probably damaging	Het
Vmn2r81	T	G	10: 79,293,737	L821V	probably damaging	Het
Vmn2r97	A	G	17: 18,940,238	D545G	probably benign	Het
Vps13c	A	T	9: 67,886,276	D437V	probably damaging	Het
Wtip	A	T	7: 34,118,938	M268K	probably benign	Het
Zfhx2	G	T	14: 55,074,732	F168L	probably benign	Het
Zscan22	G	A	7: 12,903,840	R53K	probably damaging	Het

Other mutations in Arnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Arnt2	APN	7	84285829	missense	probably benign	0.01
IGL01525:Arnt2	APN	7	84275408	missense	possibly damaging	0.70
IGL02331:Arnt2	APN	7	84265624	missense	probably damaging	1.00
IGL02483:Arnt2	APN	7	84251397	missense	probably damaging	1.00
IGL02863:Arnt2	APN	7	84267937	missense	probably damaging	1.00
IGL03207:Arnt2	APN	7	84343834	missense	possibly damaging	0.93
Arnold2	UTSW	7	84347530	missense	probably damaging	1.00
porker	UTSW	7	84343942	missense	probably damaging	1.00
R0024:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0060:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0113:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0114:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0201:Arnt2	UTSW	7	84361659	nonsense	probably null
R0514:Arnt2	UTSW	7	84304859	missense	probably benign	0.00
R0863:Arnt2	UTSW	7	84265584	missense	probably damaging	1.00
R1800:Arnt2	UTSW	7	84275375	missense	probably damaging	1.00
R1964:Arnt2	UTSW	7	84343789	missense	possibly damaging	0.55
R2061:Arnt2	UTSW	7	84343870	missense	probably damaging	1.00
R2216:Arnt2	UTSW	7	84275351	missense	probably damaging	0.99
R3107:Arnt2	UTSW	7	84262444	missense	possibly damaging	0.95
R3410:Arnt2	UTSW	7	84275447	missense	probably damaging	1.00
R3739:Arnt2	UTSW	7	84343801	missense	probably null	1.00
R4258:Arnt2	UTSW	7	84310955	missense	probably damaging	0.98
R4486:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4489:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4668:Arnt2	UTSW	7	84275386	missense	probably damaging	1.00
R5685:Arnt2	UTSW	7	84263265	missense	probably benign	0.00
R5876:Arnt2	UTSW	7	84347512	missense	probably damaging	1.00
R5923:Arnt2	UTSW	7	84262533	missense	probably benign	0.32
R5926:Arnt2	UTSW	7	84343946	missense	probably damaging	0.99
R6122:Arnt2	UTSW	7	84361565	missense	probably damaging	1.00
R7021:Arnt2	UTSW	7	84343942	missense	probably damaging	1.00
R7895:Arnt2	UTSW	7	84305198	missense	probably benign
R7978:Arnt2	UTSW	7	84305198	missense	probably benign
R7981:Arnt2	UTSW	7	84268947	intron	probably null
X0066:Arnt2	UTSW	7	84285784	missense	possibly damaging	0.93
Z1176:Arnt2	UTSW	7	84263196	missense	probably benign	0.41
Z1177:Arnt2	UTSW	7	84263207	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TCTAGCTTCCAAATGTGTTTACTGG -3'
(R):5'- GGAAGCCGCTGATGGATTTCTG -3'

Sequencing Primer
(F):5'- CCTAGAAATCACTCTGTTGACCAGG -3'
(R):5'- GTTTGTGGTGGCAGCTGAGAC -3'

Posted On

2014-08-01