Mutagenetix > Incidental Mutation

Incidental Mutation 'R1944:Col6a6'

216471

Institutional Source

Beutler Lab

Gene Symbol

Col6a6

Ensembl Gene

ENSMUSG00000043719

Gene Name

collagen, type VI, alpha 6

Synonyms

E330026B02Rik

MMRRC Submission

039962-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R1944 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105687809-105828160 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105709384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1813 (R1813C)

Ref Sequence

ENSEMBL: ENSMUSP00000096040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]

AlphaFold

Q8C6K9

Predicted Effect

probably damaging
Transcript: ENSMUST00000098441
AA Change: R1813C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: R1813C

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	3.3e-9	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166431
AA Change: R1813C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: R1813C

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	9.3e-10	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	T	5: 8,930,796	N593Y	probably damaging	Het
Adamts16	C	T	13: 70,791,886	S406N	possibly damaging	Het
Adgrg1	G	A	8: 95,007,300	V350I	probably damaging	Het
Adgrv1	A	T	13: 81,510,911	D2051E	probably damaging	Het
Adrb2	C	A	18: 62,179,413	V114L	probably damaging	Het
Ago3	A	G	4: 126,353,727	V599A	probably damaging	Het
AI837181	T	C	19: 5,426,229	V140A	probably damaging	Het
Ankrd16	T	A	2: 11,783,632		probably null	Het
Arnt2	A	G	7: 84,343,751	S194P	probably benign	Het
Art2b	T	C	7: 101,579,946	N249D	probably benign	Het
Atat1	A	G	17: 35,909,340	L60P	probably damaging	Het
Atp2b1	A	T	10: 99,022,931	I1159F	probably damaging	Het
Atrip	T	A	9: 109,071,867	I135F	probably damaging	Het
Bbs4	T	G	9: 59,330,415		probably null	Het
Bdp1	A	T	13: 100,074,381		probably null	Het
Best2	A	G	8: 85,010,761		probably null	Het
Cacna1c	A	G	6: 118,606,266	I1516T	probably damaging	Het
Cadps2	T	C	6: 23,599,480	I276V	probably damaging	Het
Carmil3	T	C	14: 55,498,630	S610P	probably damaging	Het
Caskin1	A	G	17: 24,500,771	I375V	probably damaging	Het
Ccdc92b	A	G	11: 74,630,009	I46V	probably benign	Het
Clec11a	G	T	7: 44,304,674	T285K	probably benign	Het
Clk3	G	T	9: 57,765,186	T111K	probably benign	Het
Col7a1	G	A	9: 108,960,010	V798I	unknown	Het
Ctrb1	C	A	8: 111,689,519	W45L	probably damaging	Het
Cubn	T	A	2: 13,278,538	S3530C	probably benign	Het
Dio1	A	G	4: 107,306,780		probably null	Het
Dock5	A	T	14: 67,757,135	Y1825*	probably null	Het
Duox1	A	T	2: 122,346,520	Q1476L	probably damaging	Het
Dync2h1	A	T	9: 7,001,377	H3877Q	probably damaging	Het
Enkd1	A	G	8: 105,707,576	S85P	probably damaging	Het
Erap1	A	G	13: 74,646,639	D139G	probably benign	Het
Ern1	A	G	11: 106,421,950	S202P	probably damaging	Het
F11r	T	C	1: 171,461,891	Y261H	probably damaging	Het
Fam129a	T	C	1: 151,696,228	I308T	probably damaging	Het
Glp2r	A	T	11: 67,746,792	S138T	probably benign	Het
Gm11127	A	G	17: 36,058,005	F61S	probably damaging	Het
Gm765	A	G	6: 98,248,190	I44T	probably benign	Het
Gm8251	G	A	1: 44,061,849	P30S	probably damaging	Het
Gpt2	A	G	8: 85,517,996	Y306C	probably damaging	Het
Grid2	G	C	6: 63,909,061	R147P	probably damaging	Het
Gtdc1	A	G	2: 44,752,186	F128L	possibly damaging	Het
Hacd4	T	C	4: 88,423,066	T154A	possibly damaging	Het
Heatr6	G	T	11: 83,769,220	L530F	probably damaging	Het
Hoxd8	A	T	2: 74,706,712	D256V	probably damaging	Het
Ints6	T	C	14: 62,693,640	N865D	probably benign	Het
Itpkc	G	T	7: 27,227,659	P277T	possibly damaging	Het
Klc4	T	C	17: 46,636,627	N383S	probably damaging	Het
Klra6	T	C	6: 130,018,945	Y150C	possibly damaging	Het
Krt32	T	A	11: 100,084,844		probably null	Het
Krt33a	T	C	11: 100,012,709	N199S	probably benign	Het
Krt39	A	C	11: 99,519,823	D174E	probably damaging	Het
Krt82	G	A	15: 101,548,535	R137W	probably damaging	Het
Lgmn	A	T	12: 102,401,924	S193T	probably damaging	Het
Limch1	G	A	5: 66,999,099	R300H	probably damaging	Het
Lrpap1	T	A	5: 35,097,630	I221F	probably benign	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Macf1	T	C	4: 123,370,666	D4883G	probably damaging	Het
Man2b2	A	G	5: 36,816,180	V485A	probably benign	Het
Map3k19	T	C	1: 127,823,122	T831A	probably benign	Het
Megf6	C	G	4: 154,256,066	D471E	possibly damaging	Het
Mettl8	A	T	2: 70,973,279	F268L	probably damaging	Het
Miip	T	C	4: 147,865,965	E58G	probably benign	Het
Mycbp2	T	A	14: 103,229,404	S1308C	probably damaging	Het
Myo15	T	C	11: 60,502,083	F2194L	probably damaging	Het
Nav3	T	C	10: 109,716,530	N1817S	probably damaging	Het
Ndel1	A	T	11: 68,829,920	H313Q	probably benign	Het
Neb	A	T	2: 52,228,850	H3931Q	probably benign	Het
Nfkb2	T	A	19: 46,308,052	V253E	probably damaging	Het
Nono	T	C	X: 101,441,823		probably null	Het
Npc1l1	T	A	11: 6,214,588	I1154F	possibly damaging	Het
Nr2e1	T	C	10: 42,572,778	T155A	probably benign	Het
Olfr1359	A	T	13: 21,703,117	I39F	possibly damaging	Het
Oosp2	C	T	19: 11,649,595		probably null	Het
Pdap1	G	A	5: 145,132,916	T93I	probably benign	Het
Pde6c	T	A	19: 38,157,519	D418E	probably damaging	Het
Pdha1	T	A	X: 160,127,358	D255V	probably damaging	Het
Polr2h	T	A	16: 20,719,046	D64E	probably benign	Het
Psmb3	T	C	11: 97,711,155	F117S	probably benign	Het
Ptprq	A	T	10: 107,582,388	M1709K	probably benign	Het
Rbm15	C	T	3: 107,331,552	R510H	probably damaging	Het
Rgs7	A	T	1: 175,153,203	M85K	possibly damaging	Het
Rpl27-ps3	T	A	18: 6,332,669	V13D	probably damaging	Het
Rtp2	T	A	16: 23,927,566	D105V	possibly damaging	Het
Scd3	T	C	19: 44,235,780	Y151H	probably benign	Het
Slc30a6	T	G	17: 74,408,863	V106G	probably damaging	Het
Slco1a4	T	C	6: 141,839,550	I105V	probably benign	Het
Sun3	T	C	11: 9,038,296	I9V	probably benign	Het
Syne2	T	C	12: 76,074,544	V5928A	probably damaging	Het
Tbr1	T	A	2: 61,812,256	S622T	probably damaging	Het
Tgm3	A	G	2: 130,029,969	N306D	probably damaging	Het
Tmem132d	A	G	5: 127,783,764	*1098Q	probably null	Het
Tmem140	T	C	6: 34,872,812	Y88H	probably damaging	Het
Trim60	A	T	8: 65,001,312	V95E	possibly damaging	Het
Vamp3	A	G	4: 151,056,160		probably null	Het
Vmn1r235	A	C	17: 21,261,523	T37P	probably damaging	Het
Vmn2r81	T	G	10: 79,293,737	L821V	probably damaging	Het
Vmn2r97	A	G	17: 18,940,238	D545G	probably benign	Het
Vps13c	A	T	9: 67,886,276	D437V	probably damaging	Het
Wtip	A	T	7: 34,118,938	M268K	probably benign	Het
Zfhx2	G	T	14: 55,074,732	F168L	probably benign	Het
Zscan22	G	A	7: 12,903,840	R53K	probably damaging	Het

Other mutations in Col6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Col6a6	APN	9	105758191	critical splice acceptor site	probably null
IGL00768:Col6a6	APN	9	105782412	missense	probably benign	0.04
IGL00917:Col6a6	APN	9	105784254	splice site	probably benign
IGL01385:Col6a6	APN	9	105783666	missense	probably damaging	1.00
IGL01411:Col6a6	APN	9	105785958	nonsense	probably null
IGL01508:Col6a6	APN	9	105727166	splice site	probably benign
IGL01668:Col6a6	APN	9	105709271	missense	probably damaging	1.00
IGL01733:Col6a6	APN	9	105709255	missense	possibly damaging	0.92
IGL01932:Col6a6	APN	9	105689626	missense	probably benign	0.02
IGL01934:Col6a6	APN	9	105698659	critical splice donor site	probably null
IGL01944:Col6a6	APN	9	105783909	missense	probably damaging	1.00
IGL01980:Col6a6	APN	9	105780985	missense	probably damaging	0.96
IGL02114:Col6a6	APN	9	105767199	critical splice donor site	probably null
IGL02129:Col6a6	APN	9	105736340	splice site	probably benign
IGL02201:Col6a6	APN	9	105780995	missense	probably damaging	1.00
IGL02335:Col6a6	APN	9	105784101	missense	probably damaging	1.00
IGL02541:Col6a6	APN	9	105732216	missense	probably benign	0.05
IGL02574:Col6a6	APN	9	105782191	missense	probably damaging	1.00
IGL02649:Col6a6	APN	9	105727170	critical splice donor site	probably null
IGL02852:Col6a6	APN	9	105784073	missense	probably damaging	0.99
IGL03278:Col6a6	APN	9	105709452	missense	probably benign	0.01
IGL03327:Col6a6	APN	9	105767234	missense	possibly damaging	0.90
PIT4519001:Col6a6	UTSW	9	105732263	missense	probably benign	0.23
R0042:Col6a6	UTSW	9	105780697	missense	possibly damaging	0.89
R0046:Col6a6	UTSW	9	105748848	splice site	probably benign
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0140:Col6a6	UTSW	9	105702275	missense	probably damaging	1.00
R0278:Col6a6	UTSW	9	105767288	missense	possibly damaging	0.87
R0281:Col6a6	UTSW	9	105784116	missense	probably benign	0.13
R0382:Col6a6	UTSW	9	105755555	missense	probably damaging	0.98
R0389:Col6a6	UTSW	9	105784204	missense	probably benign	0.02
R0421:Col6a6	UTSW	9	105784206	missense	probably benign	0.02
R0502:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0503:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0600:Col6a6	UTSW	9	105761440	missense	probably damaging	1.00
R0626:Col6a6	UTSW	9	105777744	missense	probably benign	0.45
R0629:Col6a6	UTSW	9	105727165	splice site	probably benign
R0690:Col6a6	UTSW	9	105709486	missense	probably benign	0.01
R1155:Col6a6	UTSW	9	105782090	missense	possibly damaging	0.64
R1245:Col6a6	UTSW	9	105748910	missense	possibly damaging	0.62
R1253:Col6a6	UTSW	9	105774303	missense	probably null	0.98
R1263:Col6a6	UTSW	9	105709489	missense	probably benign	0.01
R1296:Col6a6	UTSW	9	105781091	missense	probably damaging	1.00
R1556:Col6a6	UTSW	9	105709473	missense	possibly damaging	0.82
R1600:Col6a6	UTSW	9	105778075	missense	probably damaging	1.00
R1612:Col6a6	UTSW	9	105777549	missense	probably damaging	1.00
R1613:Col6a6	UTSW	9	105732211	critical splice donor site	probably null
R1830:Col6a6	UTSW	9	105702270	missense	probably damaging	0.99
R1858:Col6a6	UTSW	9	105781102	missense	probably damaging	1.00
R1897:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R2366:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R2484:Col6a6	UTSW	9	105780804	missense	probably damaging	0.98
R3079:Col6a6	UTSW	9	105754223	missense	probably benign	0.01
R3176:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3276:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3429:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R3716:Col6a6	UTSW	9	105782174	missense	probably damaging	0.98
R3809:Col6a6	UTSW	9	105780692	missense	probably damaging	1.00
R3978:Col6a6	UTSW	9	105698879	missense	probably damaging	0.98
R4087:Col6a6	UTSW	9	105783956	missense	possibly damaging	0.68
R4382:Col6a6	UTSW	9	105783690	missense	probably damaging	1.00
R4516:Col6a6	UTSW	9	105698949	missense	possibly damaging	0.64
R4666:Col6a6	UTSW	9	105767342	missense	possibly damaging	0.93
R4905:Col6a6	UTSW	9	105767424	missense	probably damaging	1.00
R4923:Col6a6	UTSW	9	105788948	missense	probably damaging	1.00
R4951:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R5002:Col6a6	UTSW	9	105786093	missense	probably benign	0.00
R5111:Col6a6	UTSW	9	105709474	missense	possibly damaging	0.70
R5205:Col6a6	UTSW	9	105782033	missense	probably damaging	0.99
R5399:Col6a6	UTSW	9	105709107	missense	possibly damaging	0.50
R5475:Col6a6	UTSW	9	105774338	missense	probably null	0.79
R5491:Col6a6	UTSW	9	105738236	missense	probably damaging	0.98
R5758:Col6a6	UTSW	9	105761518	critical splice acceptor site	probably null
R5934:Col6a6	UTSW	9	105767075	missense	probably damaging	1.00
R6059:Col6a6	UTSW	9	105783917	missense	probably damaging	1.00
R6284:Col6a6	UTSW	9	105727227	splice site	probably null
R6425:Col6a6	UTSW	9	105698865	missense	probably benign	0.21
R6464:Col6a6	UTSW	9	105788953	start codon destroyed	probably null	0.60
R6469:Col6a6	UTSW	9	105698691	missense	probably damaging	0.97
R6520:Col6a6	UTSW	9	105785825	missense	possibly damaging	0.89
R6552:Col6a6	UTSW	9	105698913	missense	probably damaging	1.00
R6750:Col6a6	UTSW	9	105783680	missense	probably damaging	1.00
R6813:Col6a6	UTSW	9	105783941	missense	probably benign	0.32
R7032:Col6a6	UTSW	9	105767508	missense	probably damaging	0.96
R7260:Col6a6	UTSW	9	105783969	missense	probably benign	0.00
R7472:Col6a6	UTSW	9	105782423	missense	probably damaging	1.00
R7541:Col6a6	UTSW	9	105767324	missense	probably damaging	1.00
R7640:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R7645:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R7716:Col6a6	UTSW	9	105783903	missense	possibly damaging	0.84
R7866:Col6a6	UTSW	9	105689561	missense	probably damaging	0.96
R7938:Col6a6	UTSW	9	105780684	nonsense	probably null
R8016:Col6a6	UTSW	9	105767528	missense	possibly damaging	0.73
R8043:Col6a6	UTSW	9	105699020	missense	probably damaging	0.98
R8073:Col6a6	UTSW	9	105781947	missense	probably benign	0.01
R8082:Col6a6	UTSW	9	105783930	nonsense	probably null
R8243:Col6a6	UTSW	9	105699269	missense	probably damaging	1.00
R8306:Col6a6	UTSW	9	105784073	missense	probably damaging	0.96
R8324:Col6a6	UTSW	9	105755654	missense	probably benign	0.25
R8384:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R8400:Col6a6	UTSW	9	105774796	missense	probably damaging	1.00
R8523:Col6a6	UTSW	9	105774788	missense	possibly damaging	0.71
R8842:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R8862:Col6a6	UTSW	9	105786149	missense	probably damaging	1.00
R8907:Col6a6	UTSW	9	105767329	missense	probably damaging	0.99
R9021:Col6a6	UTSW	9	105709546	missense	possibly damaging	0.85
R9088:Col6a6	UTSW	9	105784077	missense	probably damaging	0.99
R9178:Col6a6	UTSW	9	105781970	missense	probably benign	0.30
R9225:Col6a6	UTSW	9	105782238	missense	possibly damaging	0.75
R9340:Col6a6	UTSW	9	105774558	missense	probably damaging	1.00
R9342:Col6a6	UTSW	9	105785973	missense	probably benign	0.00
R9360:Col6a6	UTSW	9	105767487	missense	probably benign	0.00
R9368:Col6a6	UTSW	9	105786101	missense	possibly damaging	0.48
R9398:Col6a6	UTSW	9	105774626	missense	probably benign	0.40
R9450:Col6a6	UTSW	9	105784174	missense	probably benign
R9454:Col6a6	UTSW	9	105783860	missense	probably damaging	0.99
R9458:Col6a6	UTSW	9	105709162	missense	probably benign	0.01
R9563:Col6a6	UTSW	9	105695753	missense	probably benign	0.02
R9568:Col6a6	UTSW	9	105780727	missense	possibly damaging	0.58
R9613:Col6a6	UTSW	9	105739202	missense	probably benign	0.07
R9664:Col6a6	UTSW	9	105781055	missense	probably benign	0.11
R9747:Col6a6	UTSW	9	105784040	missense	probably benign	0.29
R9760:Col6a6	UTSW	9	105782054	missense	probably damaging	0.99
X0022:Col6a6	UTSW	9	105699332	missense	probably damaging	1.00
Z1176:Col6a6	UTSW	9	105780952	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105728255	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105788895	missense	probably null	0.24

Predicted Primers

PCR Primer
(F):5'- AACGTGGCGATTCTTCTCAC -3'
(R):5'- ATCCTACATGACAGGAAGCATGG -3'

Sequencing Primer
(F):5'- TTCTCACATGAGCCCCTGGAAG -3'
(R):5'- CAGTGCATCCAACTGAGTTG -3'

Posted On

2014-08-01