Incidental Mutation 'R1944:Nr2e1'
ID 216475
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Name nuclear receptor subfamily 2, group E, member 1
Synonyms tailless, Mtll, Tlx, Nr2e1
MMRRC Submission 039962-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.885) question?
Stock # R1944 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 42437959-42459628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42448774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 155 (T155A)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105498]
AlphaFold Q64104
Predicted Effect probably benign
Transcript: ENSMUST00000019938
AA Change: T155A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: T155A

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105498
SMART Domains Protein: ENSMUSP00000101137
Gene: ENSMUSG00000019803

DomainStartEndE-ValueType
HOLI 3 142 2.56e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126848
SMART Domains Protein: ENSMUSP00000116439
Gene: ENSMUSG00000019803

DomainStartEndE-ValueType
ZnF_C4 9 82 2.04e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143891
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,980,796 (GRCm39) N593Y probably damaging Het
Adamts16 C T 13: 70,940,005 (GRCm39) S406N possibly damaging Het
Adgrg1 G A 8: 95,733,928 (GRCm39) V350I probably damaging Het
Adgrv1 A T 13: 81,659,030 (GRCm39) D2051E probably damaging Het
Adrb2 C A 18: 62,312,484 (GRCm39) V114L probably damaging Het
Ago3 A G 4: 126,247,520 (GRCm39) V599A probably damaging Het
AI837181 T C 19: 5,476,257 (GRCm39) V140A probably damaging Het
Ankrd16 T A 2: 11,788,443 (GRCm39) probably null Het
Arnt2 A G 7: 83,992,959 (GRCm39) S194P probably benign Het
Art2b T C 7: 101,229,153 (GRCm39) N249D probably benign Het
Atat1 A G 17: 36,220,232 (GRCm39) L60P probably damaging Het
Atp2b1 A T 10: 98,858,793 (GRCm39) I1159F probably damaging Het
Atrip T A 9: 108,900,935 (GRCm39) I135F probably damaging Het
Bbs4 T G 9: 59,237,698 (GRCm39) probably null Het
Bdp1 A T 13: 100,210,889 (GRCm39) probably null Het
Best2 A G 8: 85,737,390 (GRCm39) probably null Het
Cacna1c A G 6: 118,583,227 (GRCm39) I1516T probably damaging Het
Cadps2 T C 6: 23,599,479 (GRCm39) I276V probably damaging Het
Carmil3 T C 14: 55,736,087 (GRCm39) S610P probably damaging Het
Caskin1 A G 17: 24,719,745 (GRCm39) I375V probably damaging Het
Ccdc168 G A 1: 44,101,009 (GRCm39) P30S probably damaging Het
Ccdc92b A G 11: 74,520,835 (GRCm39) I46V probably benign Het
Clec11a G T 7: 43,954,098 (GRCm39) T285K probably benign Het
Clk3 G T 9: 57,672,469 (GRCm39) T111K probably benign Het
Col6a6 G A 9: 105,586,583 (GRCm39) R1813C probably damaging Het
Col7a1 G A 9: 108,789,078 (GRCm39) V798I unknown Het
Ctrb1 C A 8: 112,416,151 (GRCm39) W45L probably damaging Het
Cubn T A 2: 13,283,349 (GRCm39) S3530C probably benign Het
Dio1 A G 4: 107,163,977 (GRCm39) probably null Het
Dock5 A T 14: 67,994,584 (GRCm39) Y1825* probably null Het
Duox1 A T 2: 122,177,001 (GRCm39) Q1476L probably damaging Het
Dync2h1 A T 9: 7,001,377 (GRCm39) H3877Q probably damaging Het
Enkd1 A G 8: 106,434,208 (GRCm39) S85P probably damaging Het
Erap1 A G 13: 74,794,758 (GRCm39) D139G probably benign Het
Ern1 A G 11: 106,312,776 (GRCm39) S202P probably damaging Het
F11r T C 1: 171,289,459 (GRCm39) Y261H probably damaging Het
Glp2r A T 11: 67,637,618 (GRCm39) S138T probably benign Het
Gpt2 A G 8: 86,244,625 (GRCm39) Y306C probably damaging Het
Grid2 G C 6: 63,886,045 (GRCm39) R147P probably damaging Het
Gtdc1 A G 2: 44,642,198 (GRCm39) F128L possibly damaging Het
H2-T15 A G 17: 36,368,897 (GRCm39) F61S probably damaging Het
Hacd4 T C 4: 88,341,303 (GRCm39) T154A possibly damaging Het
Heatr6 G T 11: 83,660,046 (GRCm39) L530F probably damaging Het
Hoxd8 A T 2: 74,537,056 (GRCm39) D256V probably damaging Het
Ints6 T C 14: 62,931,089 (GRCm39) N865D probably benign Het
Itpkc G T 7: 26,927,084 (GRCm39) P277T possibly damaging Het
Klc4 T C 17: 46,947,553 (GRCm39) N383S probably damaging Het
Klra6 T C 6: 129,995,908 (GRCm39) Y150C possibly damaging Het
Krt32 T A 11: 99,975,670 (GRCm39) probably null Het
Krt33a T C 11: 99,903,535 (GRCm39) N199S probably benign Het
Krt39 A C 11: 99,410,649 (GRCm39) D174E probably damaging Het
Krt82 G A 15: 101,456,970 (GRCm39) R137W probably damaging Het
Lgmn A T 12: 102,368,183 (GRCm39) S193T probably damaging Het
Limch1 G A 5: 67,156,442 (GRCm39) R300H probably damaging Het
Lrpap1 T A 5: 35,254,974 (GRCm39) I221F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,235,260 (GRCm39) probably null Het
Macf1 T C 4: 123,264,459 (GRCm39) D4883G probably damaging Het
Man2b2 A G 5: 36,973,524 (GRCm39) V485A probably benign Het
Map3k19 T C 1: 127,750,859 (GRCm39) T831A probably benign Het
Mdfic2 A G 6: 98,225,151 (GRCm39) I44T probably benign Het
Megf6 C G 4: 154,340,523 (GRCm39) D471E possibly damaging Het
Mettl8 A T 2: 70,803,623 (GRCm39) F268L probably damaging Het
Miip T C 4: 147,950,422 (GRCm39) E58G probably benign Het
Mycbp2 T A 14: 103,466,840 (GRCm39) S1308C probably damaging Het
Myo15a T C 11: 60,392,909 (GRCm39) F2194L probably damaging Het
Nav3 T C 10: 109,552,391 (GRCm39) N1817S probably damaging Het
Ndel1 A T 11: 68,720,746 (GRCm39) H313Q probably benign Het
Neb A T 2: 52,118,862 (GRCm39) H3931Q probably benign Het
Nfkb2 T A 19: 46,296,491 (GRCm39) V253E probably damaging Het
Niban1 T C 1: 151,571,979 (GRCm39) I308T probably damaging Het
Nono T C X: 100,485,429 (GRCm39) probably null Het
Npc1l1 T A 11: 6,164,588 (GRCm39) I1154F possibly damaging Het
Oosp2 C T 19: 11,626,959 (GRCm39) probably null Het
Or2b2 A T 13: 21,887,287 (GRCm39) I39F possibly damaging Het
Pdap1 G A 5: 145,069,726 (GRCm39) T93I probably benign Het
Pde6c T A 19: 38,145,967 (GRCm39) D418E probably damaging Het
Pdha1 T A X: 158,910,354 (GRCm39) D255V probably damaging Het
Polr2h T A 16: 20,537,796 (GRCm39) D64E probably benign Het
Psmb3 T C 11: 97,601,981 (GRCm39) F117S probably benign Het
Ptprq A T 10: 107,418,249 (GRCm39) M1709K probably benign Het
Rbm15 C T 3: 107,238,868 (GRCm39) R510H probably damaging Het
Rgs7 A T 1: 174,980,769 (GRCm39) M85K possibly damaging Het
Rpl27-ps3 T A 18: 6,332,669 (GRCm39) V13D probably damaging Het
Rtp2 T A 16: 23,746,316 (GRCm39) D105V possibly damaging Het
Scd3 T C 19: 44,224,219 (GRCm39) Y151H probably benign Het
Slc30a6 T G 17: 74,715,858 (GRCm39) V106G probably damaging Het
Slco1a4 T C 6: 141,785,276 (GRCm39) I105V probably benign Het
Sun3 T C 11: 8,988,296 (GRCm39) I9V probably benign Het
Syne2 T C 12: 76,121,318 (GRCm39) V5928A probably damaging Het
Tbr1 T A 2: 61,642,600 (GRCm39) S622T probably damaging Het
Tgm3 A G 2: 129,871,889 (GRCm39) N306D probably damaging Het
Tmem132d A G 5: 127,860,828 (GRCm39) *1098Q probably null Het
Tmem140 T C 6: 34,849,747 (GRCm39) Y88H probably damaging Het
Trim60 A T 8: 65,453,964 (GRCm39) V95E possibly damaging Het
Vamp3 A G 4: 151,140,617 (GRCm39) probably null Het
Vmn1r235 A C 17: 21,481,785 (GRCm39) T37P probably damaging Het
Vmn2r81 T G 10: 79,129,571 (GRCm39) L821V probably damaging Het
Vmn2r97 A G 17: 19,160,500 (GRCm39) D545G probably benign Het
Vps13c A T 9: 67,793,558 (GRCm39) D437V probably damaging Het
Wtip A T 7: 33,818,363 (GRCm39) M268K probably benign Het
Zfhx2 G T 14: 55,312,189 (GRCm39) F168L probably benign Het
Zscan22 G A 7: 12,637,767 (GRCm39) R53K probably damaging Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42,444,449 (GRCm39) missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42,443,969 (GRCm39) missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42,443,975 (GRCm39) missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42,447,478 (GRCm39) missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42,444,377 (GRCm39) missense probably damaging 1.00
Dubious UTSW 10 42,447,483 (GRCm39) nonsense probably null
BB010:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42,443,964 (GRCm39) missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42,458,905 (GRCm39) splice site probably null
R1879:Nr2e1 UTSW 10 42,444,367 (GRCm39) critical splice donor site probably null
R2426:Nr2e1 UTSW 10 42,439,481 (GRCm39) missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42,444,441 (GRCm39) missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42,454,187 (GRCm39) missense probably benign
R5305:Nr2e1 UTSW 10 42,447,483 (GRCm39) nonsense probably null
R5316:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42,448,780 (GRCm39) missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42,448,765 (GRCm39) missense probably benign
R7040:Nr2e1 UTSW 10 42,444,374 (GRCm39) missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42,439,475 (GRCm39) missense probably damaging 1.00
R7765:Nr2e1 UTSW 10 42,450,433 (GRCm39) missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R8158:Nr2e1 UTSW 10 42,458,881 (GRCm39) missense probably benign 0.00
R8342:Nr2e1 UTSW 10 42,444,425 (GRCm39) missense probably damaging 1.00
R8916:Nr2e1 UTSW 10 42,443,864 (GRCm39) missense possibly damaging 0.94
R9145:Nr2e1 UTSW 10 42,448,948 (GRCm39) missense probably benign 0.02
R9189:Nr2e1 UTSW 10 42,454,268 (GRCm39) missense probably damaging 0.99
R9381:Nr2e1 UTSW 10 42,439,468 (GRCm39) missense probably damaging 1.00
R9499:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R9552:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
Z1177:Nr2e1 UTSW 10 42,444,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCATCTTTGGCTCAACAGAAG -3'
(R):5'- TTGTCTCTGTAGCCGTGCAG -3'

Sequencing Primer
(F):5'- CTCAACAGAAGGAGCAAGAGACTC -3'
(R):5'- TCGGACGTCCACCATCC -3'
Posted On 2014-08-01