Incidental Mutation 'R1944:Nav3'
ID216479
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 039962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1944 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109716530 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1817 (N1817S)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably damaging
Transcript: ENSMUST00000032719
AA Change: N1817S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: N1817S

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161582
SMART Domains Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
low complexity region 84 95 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 354 372 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 604 618 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
coiled coil region 842 933 N/A INTRINSIC
low complexity region 952 969 N/A INTRINSIC
low complexity region 992 1003 N/A INTRINSIC
low complexity region 1026 1051 N/A INTRINSIC
low complexity region 1052 1065 N/A INTRINSIC
coiled coil region 1071 1112 N/A INTRINSIC
low complexity region 1118 1141 N/A INTRINSIC
AAA 1299 1454 4.94e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,930,796 N593Y probably damaging Het
Adamts16 C T 13: 70,791,886 S406N possibly damaging Het
Adgrg1 G A 8: 95,007,300 V350I probably damaging Het
Adgrv1 A T 13: 81,510,911 D2051E probably damaging Het
Adrb2 C A 18: 62,179,413 V114L probably damaging Het
Ago3 A G 4: 126,353,727 V599A probably damaging Het
AI837181 T C 19: 5,426,229 V140A probably damaging Het
Ankrd16 T A 2: 11,783,632 probably null Het
Arnt2 A G 7: 84,343,751 S194P probably benign Het
Art2b T C 7: 101,579,946 N249D probably benign Het
Atat1 A G 17: 35,909,340 L60P probably damaging Het
Atp2b1 A T 10: 99,022,931 I1159F probably damaging Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bbs4 T G 9: 59,330,415 probably null Het
Bdp1 A T 13: 100,074,381 probably null Het
Best2 A G 8: 85,010,761 probably null Het
Cacna1c A G 6: 118,606,266 I1516T probably damaging Het
Cadps2 T C 6: 23,599,480 I276V probably damaging Het
Carmil3 T C 14: 55,498,630 S610P probably damaging Het
Caskin1 A G 17: 24,500,771 I375V probably damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Clec11a G T 7: 44,304,674 T285K probably benign Het
Clk3 G T 9: 57,765,186 T111K probably benign Het
Col6a6 G A 9: 105,709,384 R1813C probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Ctrb1 C A 8: 111,689,519 W45L probably damaging Het
Cubn T A 2: 13,278,538 S3530C probably benign Het
Dio1 A G 4: 107,306,780 probably null Het
Dock5 A T 14: 67,757,135 Y1825* probably null Het
Duox1 A T 2: 122,346,520 Q1476L probably damaging Het
Dync2h1 A T 9: 7,001,377 H3877Q probably damaging Het
Enkd1 A G 8: 105,707,576 S85P probably damaging Het
Erap1 A G 13: 74,646,639 D139G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
F11r T C 1: 171,461,891 Y261H probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Glp2r A T 11: 67,746,792 S138T probably benign Het
Gm11127 A G 17: 36,058,005 F61S probably damaging Het
Gm765 A G 6: 98,248,190 I44T probably benign Het
Gm8251 G A 1: 44,061,849 P30S probably damaging Het
Gpt2 A G 8: 85,517,996 Y306C probably damaging Het
Grid2 G C 6: 63,909,061 R147P probably damaging Het
Gtdc1 A G 2: 44,752,186 F128L possibly damaging Het
Hacd4 T C 4: 88,423,066 T154A possibly damaging Het
Heatr6 G T 11: 83,769,220 L530F probably damaging Het
Hoxd8 A T 2: 74,706,712 D256V probably damaging Het
Ints6 T C 14: 62,693,640 N865D probably benign Het
Itpkc G T 7: 27,227,659 P277T possibly damaging Het
Klc4 T C 17: 46,636,627 N383S probably damaging Het
Klra6 T C 6: 130,018,945 Y150C possibly damaging Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Krt39 A C 11: 99,519,823 D174E probably damaging Het
Krt82 G A 15: 101,548,535 R137W probably damaging Het
Lgmn A T 12: 102,401,924 S193T probably damaging Het
Limch1 G A 5: 66,999,099 R300H probably damaging Het
Lrpap1 T A 5: 35,097,630 I221F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Macf1 T C 4: 123,370,666 D4883G probably damaging Het
Man2b2 A G 5: 36,816,180 V485A probably benign Het
Map3k19 T C 1: 127,823,122 T831A probably benign Het
Megf6 C G 4: 154,256,066 D471E possibly damaging Het
Mettl8 A T 2: 70,973,279 F268L probably damaging Het
Miip T C 4: 147,865,965 E58G probably benign Het
Mycbp2 T A 14: 103,229,404 S1308C probably damaging Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Ndel1 A T 11: 68,829,920 H313Q probably benign Het
Neb A T 2: 52,228,850 H3931Q probably benign Het
Nfkb2 T A 19: 46,308,052 V253E probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Nr2e1 T C 10: 42,572,778 T155A probably benign Het
Olfr1359 A T 13: 21,703,117 I39F possibly damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pdap1 G A 5: 145,132,916 T93I probably benign Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pdha1 T A X: 160,127,358 D255V probably damaging Het
Polr2h T A 16: 20,719,046 D64E probably benign Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Rbm15 C T 3: 107,331,552 R510H probably damaging Het
Rgs7 A T 1: 175,153,203 M85K possibly damaging Het
Rpl27-ps3 T A 18: 6,332,669 V13D probably damaging Het
Rtp2 T A 16: 23,927,566 D105V possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Slc30a6 T G 17: 74,408,863 V106G probably damaging Het
Slco1a4 T C 6: 141,839,550 I105V probably benign Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Syne2 T C 12: 76,074,544 V5928A probably damaging Het
Tbr1 T A 2: 61,812,256 S622T probably damaging Het
Tgm3 A G 2: 130,029,969 N306D probably damaging Het
Tmem132d A G 5: 127,783,764 *1098Q probably null Het
Tmem140 T C 6: 34,872,812 Y88H probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Vamp3 A G 4: 151,056,160 probably null Het
Vmn1r235 A C 17: 21,261,523 T37P probably damaging Het
Vmn2r81 T G 10: 79,293,737 L821V probably damaging Het
Vmn2r97 A G 17: 18,940,238 D545G probably benign Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Wtip A T 7: 34,118,938 M268K probably benign Het
Zfhx2 G T 14: 55,074,732 F168L probably benign Het
Zscan22 G A 7: 12,903,840 R53K probably damaging Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1834:Nav3 UTSW 10 109720022 missense probably damaging 0.99
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
R7238:Nav3 UTSW 10 109853324 missense possibly damaging 0.75
R7338:Nav3 UTSW 10 109769212 missense probably benign 0.04
R7343:Nav3 UTSW 10 109903758 missense probably damaging 0.98
R7383:Nav3 UTSW 10 109716671 missense probably damaging 0.98
R7391:Nav3 UTSW 10 109703456 missense probably benign 0.07
R7399:Nav3 UTSW 10 109852934 missense possibly damaging 0.74
R7457:Nav3 UTSW 10 109696328 nonsense probably null
R7462:Nav3 UTSW 10 109823578 missense probably damaging 1.00
R7542:Nav3 UTSW 10 109823533 missense possibly damaging 0.89
R7659:Nav3 UTSW 10 109766990 missense probably benign 0.09
R7749:Nav3 UTSW 10 109703352 missense probably damaging 0.99
R7794:Nav3 UTSW 10 109688856 missense probably benign 0.08
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACTGACAACCTAGATTTGAGC -3'
(R):5'- GCTGCTTTCAGTTCTGAACC -3'

Sequencing Primer
(F):5'- GAGCAAATCCCCCATTTTGG -3'
(R):5'- CTGAACCTATGAATAAATGCTGGC -3'
Posted On2014-08-01