Incidental Mutation 'R1945:Sned1'
ID216539
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Namesushi, nidogen and EGF-like domains 1
Synonyms6720455I24Rik, D430044C15Rik, Snep
MMRRC Submission 039963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1945 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93235841-93301065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93271238 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 457 (E457G)
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
Predicted Effect probably benign
Transcript: ENSMUST00000062202
AA Change: E457G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: E457G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185062
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,768,483 E585V probably damaging Het
4930562C15Rik A G 16: 4,835,685 I33V unknown Het
4931408C20Rik C A 1: 26,682,314 V1262F probably benign Het
Abca1 ACGTCTTCACCAGGTAATC AC 4: 53,061,509 probably null Het
Amotl2 T C 9: 102,720,554 S171P probably benign Het
Atf6 A T 1: 170,855,141 V34E probably benign Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bglap A G 3: 88,383,664 Y87H probably damaging Het
Camk2n1 G A 4: 138,456,783 V78I possibly damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Cdc14b T C 13: 64,219,890 Y208C probably damaging Het
Cdc42bpb C T 12: 111,299,133 R1455Q probably damaging Het
Cep170 C A 1: 176,793,534 G26* probably null Het
Cfap46 A G 7: 139,679,903 F217S probably damaging Het
Col11a2 A T 17: 34,059,168 D691V probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Coq8b CGCA CGCAGCA 7: 27,233,980 probably benign Het
Coq8b GCA GCAACA 7: 27,233,981 probably benign Het
Dcaf5 T C 12: 80,338,694 D886G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
Etaa1 A G 11: 17,947,233 C295R probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Ghdc C T 11: 100,769,205 A239T probably benign Het
Gm906 C T 13: 50,245,491 G933E probably damaging Het
Grik4 T C 9: 42,521,004 D899G possibly damaging Het
Hacd2 C A 16: 35,101,984 T181K possibly damaging Het
Havcr2 T C 11: 46,455,050 L17P unknown Het
Herc3 T C 6: 58,887,439 V686A probably damaging Het
Hyal3 T C 9: 107,585,472 L235P probably damaging Het
Itgb4 C T 11: 115,993,453 Q988* probably null Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Lama1 T A 17: 67,745,853 S394T probably benign Het
Lamp1 T C 8: 13,172,545 V243A probably benign Het
Loxhd1 A G 18: 77,404,808 Y1315C probably damaging Het
Macf1 A T 4: 123,490,660 L1148* probably null Het
Mill2 A G 7: 18,841,494 H42R probably benign Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Myo15b A T 11: 115,878,398 I1472F probably damaging Het
Nasp T C 4: 116,622,768 S36G possibly damaging Het
Nav2 A G 7: 49,464,872 Y868C probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Npc1l1 C T 11: 6,225,199 W592* probably null Het
Nsg2 T C 11: 32,055,068 V90A probably damaging Het
Odf4 T C 11: 68,922,157 N225S possibly damaging Het
Olfr1230 T C 2: 89,296,784 Y162C probably damaging Het
Olfr340 T C 2: 36,453,031 W149R probably damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pcdhb4 A T 18: 37,308,868 R410S probably damaging Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pik3ap1 A T 19: 41,274,337 S799T probably benign Het
Pitx2 A G 3: 129,218,536 N198S probably damaging Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Recql5 G A 11: 115,928,297 R148* probably null Het
Reep3 A G 10: 67,035,899 S97P probably damaging Het
Rnase12 T A 14: 51,057,006 Q72L possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Scn10a A T 9: 119,691,454 S127T possibly damaging Het
Scn7a A T 2: 66,675,980 W1522R probably damaging Het
Senp7 A G 16: 56,123,946 H211R probably damaging Het
Sept10 C T 10: 59,181,019 probably null Het
Serpinb6d T C 13: 33,667,680 V140A possibly damaging Het
Spag17 A C 3: 99,939,982 M76L probably benign Het
Ssfa2 T C 2: 79,662,652 V1181A probably benign Het
Sspo A T 6: 48,489,773 E105V possibly damaging Het
Stoml3 T A 3: 53,505,445 D173E possibly damaging Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Svil T C 18: 5,117,059 W2165R probably damaging Het
Tbl2 T A 5: 135,157,600 S184T possibly damaging Het
Tdrd7 A T 4: 45,965,474 T31S probably benign Het
Tmeff1 A G 4: 48,614,960 N139S possibly damaging Het
Trip13 T C 13: 73,927,924 R199G probably damaging Het
Tshb G T 3: 102,777,515 Y124* probably null Het
Ttn T C 2: 76,730,022 E29345G probably damaging Het
Usp33 T A 3: 152,379,586 S620T probably benign Het
Vipr1 G A 9: 121,668,474 G353R probably damaging Het
Vipr1 G T 9: 121,668,475 G353V probably damaging Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Ylpm1 T A 12: 85,015,418 S240T probably damaging Het
Zfp772 A G 7: 7,203,630 I354T probably benign Het
Zfp959 T A 17: 55,897,231 Y86* probably null Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0525:Sned1 UTSW 1 93271974 splice site probably null
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93283372 missense probably damaging 0.99
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93259768 missense probably damaging 1.00
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2274:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R2340:Sned1 UTSW 1 93256452 missense probably damaging 0.98
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7035:Sned1 UTSW 1 93262130 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
R7581:Sned1 UTSW 1 93256545 missense probably benign 0.00
R7679:Sned1 UTSW 1 93236038 missense unknown
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGGGAACTCACATGG -3'
(R):5'- TGGGTGAAAGAATGTGGCCC -3'

Sequencing Primer
(F):5'- GTGGGAACTCACATGGGGACC -3'
(R):5'- GTGAAAGAATGTGGCCCCCTTTTC -3'
Posted On2014-08-01