Incidental Mutation 'R1945:Atf6'
ID 216541
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms Atf6alpha, 9130025P16Rik, ESTM49
MMRRC Submission 039963-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.183) question?
Stock # R1945 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 170532243-170695340 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 170682710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 34 (V34E)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably benign
Transcript: ENSMUST00000027974
AA Change: V34E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,653,549 (GRCm39) I33V unknown Het
Abca1 ACGTCTTCACCAGGTAATC AC 4: 53,061,509 (GRCm39) probably null Het
Amotl2 T C 9: 102,597,753 (GRCm39) S171P probably benign Het
Armh4 T A 14: 50,005,940 (GRCm39) E585V probably damaging Het
Atrip T A 9: 108,900,935 (GRCm39) I135F probably damaging Het
Bglap A G 3: 88,290,971 (GRCm39) Y87H probably damaging Het
Camk2n1 G A 4: 138,184,094 (GRCm39) V78I possibly damaging Het
Ccdc92b A G 11: 74,520,835 (GRCm39) I46V probably benign Het
Cdc14b T C 13: 64,367,704 (GRCm39) Y208C probably damaging Het
Cdc42bpb C T 12: 111,265,567 (GRCm39) R1455Q probably damaging Het
Cep170 C A 1: 176,621,100 (GRCm39) G26* probably null Het
Cfap46 A G 7: 139,259,819 (GRCm39) F217S probably damaging Het
Col11a2 A T 17: 34,278,142 (GRCm39) D691V probably damaging Het
Col7a1 G A 9: 108,789,078 (GRCm39) V798I unknown Het
Coq8b CGCA CGCAGCA 7: 26,933,405 (GRCm39) probably benign Het
Coq8b GCA GCAACA 7: 26,933,406 (GRCm39) probably benign Het
Dcaf5 T C 12: 80,385,468 (GRCm39) D886G probably benign Het
Ern1 A G 11: 106,312,776 (GRCm39) S202P probably damaging Het
Etaa1 A G 11: 17,897,233 (GRCm39) C295R probably damaging Het
Ghdc C T 11: 100,660,031 (GRCm39) A239T probably benign Het
Grik4 T C 9: 42,432,300 (GRCm39) D899G possibly damaging Het
Hacd2 C A 16: 34,922,354 (GRCm39) T181K possibly damaging Het
Havcr2 T C 11: 46,345,877 (GRCm39) L17P unknown Het
Herc3 T C 6: 58,864,424 (GRCm39) V686A probably damaging Het
Hyal3 T C 9: 107,462,671 (GRCm39) L235P probably damaging Het
Itgb4 C T 11: 115,884,279 (GRCm39) Q988* probably null Het
Itprid2 T C 2: 79,492,996 (GRCm39) V1181A probably benign Het
Krt32 T A 11: 99,975,670 (GRCm39) probably null Het
Krt33a T C 11: 99,903,535 (GRCm39) N199S probably benign Het
Lama1 T A 17: 68,052,848 (GRCm39) S394T probably benign Het
Lamp1 T C 8: 13,222,545 (GRCm39) V243A probably benign Het
Loxhd1 A G 18: 77,492,504 (GRCm39) Y1315C probably damaging Het
Macf1 A T 4: 123,384,453 (GRCm39) L1148* probably null Het
Mill2 A G 7: 18,575,419 (GRCm39) H42R probably benign Het
Myo15a T C 11: 60,392,909 (GRCm39) F2194L probably damaging Het
Myo15b A T 11: 115,769,224 (GRCm39) I1472F probably damaging Het
Nasp T C 4: 116,479,965 (GRCm39) S36G possibly damaging Het
Nav2 A G 7: 49,114,620 (GRCm39) Y868C probably damaging Het
Niban1 T C 1: 151,571,979 (GRCm39) I308T probably damaging Het
Nono T C X: 100,485,429 (GRCm39) probably null Het
Npc1l1 T A 11: 6,164,588 (GRCm39) I1154F possibly damaging Het
Npc1l1 C T 11: 6,175,199 (GRCm39) W592* probably null Het
Nsg2 T C 11: 32,005,068 (GRCm39) V90A probably damaging Het
Odf4 T C 11: 68,812,983 (GRCm39) N225S possibly damaging Het
Oosp2 C T 19: 11,626,959 (GRCm39) probably null Het
Or1j12 T C 2: 36,343,043 (GRCm39) W149R probably damaging Het
Or4c123 T C 2: 89,127,128 (GRCm39) Y162C probably damaging Het
Pcdhb4 A T 18: 37,441,921 (GRCm39) R410S probably damaging Het
Pde6c T A 19: 38,145,967 (GRCm39) D418E probably damaging Het
Pik3ap1 A T 19: 41,262,776 (GRCm39) S799T probably benign Het
Pitx2 A G 3: 129,012,185 (GRCm39) N198S probably damaging Het
Psmb3 T C 11: 97,601,981 (GRCm39) F117S probably benign Het
Ptprq A T 10: 107,418,249 (GRCm39) M1709K probably benign Het
Recql5 G A 11: 115,819,123 (GRCm39) R148* probably null Het
Reep3 A G 10: 66,871,678 (GRCm39) S97P probably damaging Het
Rnase12 T A 14: 51,294,463 (GRCm39) Q72L possibly damaging Het
Scd3 T C 19: 44,224,219 (GRCm39) Y151H probably benign Het
Scn10a A T 9: 119,520,520 (GRCm39) S127T possibly damaging Het
Scn7a A T 2: 66,506,324 (GRCm39) W1522R probably damaging Het
Senp7 A G 16: 55,944,309 (GRCm39) H211R probably damaging Het
Septin10 C T 10: 59,016,841 (GRCm39) probably null Het
Serpinb6d T C 13: 33,851,663 (GRCm39) V140A possibly damaging Het
Sned1 A G 1: 93,198,960 (GRCm39) E457G probably benign Het
Spag17 A C 3: 99,847,298 (GRCm39) M76L probably benign Het
Spata31e2 C A 1: 26,721,395 (GRCm39) V1262F probably benign Het
Spata31e3 C T 13: 50,399,527 (GRCm39) G933E probably damaging Het
Sspo A T 6: 48,466,707 (GRCm39) E105V possibly damaging Het
Stoml3 T A 3: 53,412,866 (GRCm39) D173E possibly damaging Het
Sun3 T C 11: 8,988,296 (GRCm39) I9V probably benign Het
Svil T C 18: 5,117,059 (GRCm39) W2165R probably damaging Het
Tbl2 T A 5: 135,186,454 (GRCm39) S184T possibly damaging Het
Tdrd7 A T 4: 45,965,474 (GRCm39) T31S probably benign Het
Tmeff1 A G 4: 48,614,960 (GRCm39) N139S possibly damaging Het
Trip13 T C 13: 74,076,043 (GRCm39) R199G probably damaging Het
Tshb G T 3: 102,684,831 (GRCm39) Y124* probably null Het
Ttn T C 2: 76,560,366 (GRCm39) E29345G probably damaging Het
Usp33 T A 3: 152,085,223 (GRCm39) S620T probably benign Het
Vipr1 G A 9: 121,497,540 (GRCm39) G353R probably damaging Het
Vipr1 G T 9: 121,497,541 (GRCm39) G353V probably damaging Het
Vps13c A T 9: 67,793,558 (GRCm39) D437V probably damaging Het
Ylpm1 T A 12: 85,062,192 (GRCm39) S240T probably damaging Het
Zfp772 A G 7: 7,206,629 (GRCm39) I354T probably benign Het
Zfp959 T A 17: 56,204,231 (GRCm39) Y86* probably null Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170,616,175 (GRCm39) critical splice donor site probably null
IGL01431:Atf6 APN 1 170,680,571 (GRCm39) splice site probably benign
IGL01755:Atf6 APN 1 170,616,180 (GRCm39) missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170,646,989 (GRCm39) missense probably damaging 0.99
IGL02416:Atf6 APN 1 170,574,726 (GRCm39) nonsense probably null
IGL02903:Atf6 APN 1 170,627,283 (GRCm39) missense probably benign 0.00
IGL02989:Atf6 APN 1 170,616,252 (GRCm39) splice site probably benign
IGL03209:Atf6 APN 1 170,662,463 (GRCm39) missense probably benign
R0455:Atf6 UTSW 1 170,662,492 (GRCm39) missense probably benign 0.00
R0467:Atf6 UTSW 1 170,621,589 (GRCm39) missense probably damaging 1.00
R0491:Atf6 UTSW 1 170,614,913 (GRCm39) critical splice donor site probably null
R0784:Atf6 UTSW 1 170,537,516 (GRCm39) missense probably benign 0.19
R1486:Atf6 UTSW 1 170,622,260 (GRCm39) missense probably damaging 1.00
R1850:Atf6 UTSW 1 170,646,855 (GRCm39) missense probably damaging 1.00
R2164:Atf6 UTSW 1 170,622,304 (GRCm39) missense probably damaging 1.00
R3782:Atf6 UTSW 1 170,622,336 (GRCm39) nonsense probably null
R4454:Atf6 UTSW 1 170,621,608 (GRCm39) missense probably damaging 0.99
R4631:Atf6 UTSW 1 170,574,766 (GRCm39) splice site probably null
R4676:Atf6 UTSW 1 170,614,979 (GRCm39) missense probably damaging 1.00
R5772:Atf6 UTSW 1 170,574,758 (GRCm39) missense probably damaging 1.00
R5860:Atf6 UTSW 1 170,669,345 (GRCm39) missense possibly damaging 0.95
R5860:Atf6 UTSW 1 170,669,344 (GRCm39) missense probably damaging 1.00
R5950:Atf6 UTSW 1 170,662,448 (GRCm39) missense probably damaging 1.00
R6242:Atf6 UTSW 1 170,621,545 (GRCm39) missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170,695,238 (GRCm39) missense probably benign 0.00
R7032:Atf6 UTSW 1 170,627,181 (GRCm39) critical splice donor site probably null
R7472:Atf6 UTSW 1 170,643,060 (GRCm39) missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170,622,275 (GRCm39) missense probably benign
R8002:Atf6 UTSW 1 170,646,823 (GRCm39) missense probably benign 0.43
R8860:Atf6 UTSW 1 170,680,535 (GRCm39) missense probably null 0.95
R8956:Atf6 UTSW 1 170,621,576 (GRCm39) missense probably damaging 0.98
R9090:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9271:Atf6 UTSW 1 170,622,245 (GRCm39) missense probably damaging 1.00
R9323:Atf6 UTSW 1 170,682,682 (GRCm39) nonsense probably null
R9500:Atf6 UTSW 1 170,574,708 (GRCm39) missense probably damaging 0.98
R9594:Atf6 UTSW 1 170,668,402 (GRCm39) missense probably benign 0.18
R9733:Atf6 UTSW 1 170,662,402 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATCTGGATCTCTCTTATGGCAAAC -3'
(R):5'- CACATTGCTTGAGCTTGTCAG -3'

Sequencing Primer
(F):5'- CTGTACTTATTGACTACAAGAGGTGC -3'
(R):5'- TTGTCAGCAGCAGCAGTG -3'
Posted On 2014-08-01