Mutagenetix > Incidental Mutations

Incidental Mutation 'R1945:Vps13c'

216580

Institutional Source

Beutler Lab

Gene Symbol

Vps13c

Ensembl Gene

ENSMUSG00000035284

Gene Name

vacuolar protein sorting 13C

Synonyms

C230055H22Rik

MMRRC Submission

039963-MU

Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1945 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67840396-67995638 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 67886276 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 437 (D437V)

Ref Sequence

ENSEMBL: ENSMUSP00000077040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000217386]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077879
AA Change: D437V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: D437V

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000217386
AA Change: D437V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,768,483	E585V	probably damaging	Het
4930562C15Rik	A	G	16: 4,835,685	I33V	unknown	Het
4931408C20Rik	C	A	1: 26,682,314	V1262F	probably benign	Het
Abca1	ACGTCTTCACCAGGTAATC	AC	4: 53,061,509		probably null	Het
Amotl2	T	C	9: 102,720,554	S171P	probably benign	Het
Atf6	A	T	1: 170,855,141	V34E	probably benign	Het
Atrip	T	A	9: 109,071,867	I135F	probably damaging	Het
Bglap	A	G	3: 88,383,664	Y87H	probably damaging	Het
Camk2n1	G	A	4: 138,456,783	V78I	possibly damaging	Het
Ccdc92b	A	G	11: 74,630,009	I46V	probably benign	Het
Cdc14b	T	C	13: 64,219,890	Y208C	probably damaging	Het
Cdc42bpb	C	T	12: 111,299,133	R1455Q	probably damaging	Het
Cep170	C	A	1: 176,793,534	G26*	probably null	Het
Cfap46	A	G	7: 139,679,903	F217S	probably damaging	Het
Col11a2	A	T	17: 34,059,168	D691V	probably damaging	Het
Col7a1	G	A	9: 108,960,010	V798I	unknown	Het
Coq8b	CGCA	CGCAGCA	7: 27,233,980		probably benign	Het
Coq8b	GCA	GCAACA	7: 27,233,981		probably benign	Het
Dcaf5	T	C	12: 80,338,694	D886G	probably benign	Het
Ern1	A	G	11: 106,421,950	S202P	probably damaging	Het
Etaa1	A	G	11: 17,947,233	C295R	probably damaging	Het
Fam129a	T	C	1: 151,696,228	I308T	probably damaging	Het
Ghdc	C	T	11: 100,769,205	A239T	probably benign	Het
Gm906	C	T	13: 50,245,491	G933E	probably damaging	Het
Grik4	T	C	9: 42,521,004	D899G	possibly damaging	Het
Hacd2	C	A	16: 35,101,984	T181K	possibly damaging	Het
Havcr2	T	C	11: 46,455,050	L17P	unknown	Het
Herc3	T	C	6: 58,887,439	V686A	probably damaging	Het
Hyal3	T	C	9: 107,585,472	L235P	probably damaging	Het
Itgb4	C	T	11: 115,993,453	Q988*	probably null	Het
Krt32	T	A	11: 100,084,844		probably null	Het
Krt33a	T	C	11: 100,012,709	N199S	probably benign	Het
Lama1	T	A	17: 67,745,853	S394T	probably benign	Het
Lamp1	T	C	8: 13,172,545	V243A	probably benign	Het
Loxhd1	A	G	18: 77,404,808	Y1315C	probably damaging	Het
Macf1	A	T	4: 123,490,660	L1148*	probably null	Het
Mill2	A	G	7: 18,841,494	H42R	probably benign	Het
Myo15	T	C	11: 60,502,083	F2194L	probably damaging	Het
Myo15b	A	T	11: 115,878,398	I1472F	probably damaging	Het
Nasp	T	C	4: 116,622,768	S36G	possibly damaging	Het
Nav2	A	G	7: 49,464,872	Y868C	probably damaging	Het
Nono	T	C	X: 101,441,823		probably null	Het
Npc1l1	C	T	11: 6,225,199	W592*	probably null	Het
Npc1l1	T	A	11: 6,214,588	I1154F	possibly damaging	Het
Nsg2	T	C	11: 32,055,068	V90A	probably damaging	Het
Odf4	T	C	11: 68,922,157	N225S	possibly damaging	Het
Olfr1230	T	C	2: 89,296,784	Y162C	probably damaging	Het
Olfr340	T	C	2: 36,453,031	W149R	probably damaging	Het
Oosp2	C	T	19: 11,649,595		probably null	Het
Pcdhb4	A	T	18: 37,308,868	R410S	probably damaging	Het
Pde6c	T	A	19: 38,157,519	D418E	probably damaging	Het
Pik3ap1	A	T	19: 41,274,337	S799T	probably benign	Het
Pitx2	A	G	3: 129,218,536	N198S	probably damaging	Het
Psmb3	T	C	11: 97,711,155	F117S	probably benign	Het
Ptprq	A	T	10: 107,582,388	M1709K	probably benign	Het
Recql5	G	A	11: 115,928,297	R148*	probably null	Het
Reep3	A	G	10: 67,035,899	S97P	probably damaging	Het
Rnase12	T	A	14: 51,057,006	Q72L	possibly damaging	Het
Scd3	T	C	19: 44,235,780	Y151H	probably benign	Het
Scn10a	A	T	9: 119,691,454	S127T	possibly damaging	Het
Scn7a	A	T	2: 66,675,980	W1522R	probably damaging	Het
Senp7	A	G	16: 56,123,946	H211R	probably damaging	Het
Sept10	C	T	10: 59,181,019		probably null	Het
Serpinb6d	T	C	13: 33,667,680	V140A	possibly damaging	Het
Sned1	A	G	1: 93,271,238	E457G	probably benign	Het
Spag17	A	C	3: 99,939,982	M76L	probably benign	Het
Ssfa2	T	C	2: 79,662,652	V1181A	probably benign	Het
Sspo	A	T	6: 48,489,773	E105V	possibly damaging	Het
Stoml3	T	A	3: 53,505,445	D173E	possibly damaging	Het
Sun3	T	C	11: 9,038,296	I9V	probably benign	Het
Svil	T	C	18: 5,117,059	W2165R	probably damaging	Het
Tbl2	T	A	5: 135,157,600	S184T	possibly damaging	Het
Tdrd7	A	T	4: 45,965,474	T31S	probably benign	Het
Tmeff1	A	G	4: 48,614,960	N139S	possibly damaging	Het
Trip13	T	C	13: 73,927,924	R199G	probably damaging	Het
Tshb	G	T	3: 102,777,515	Y124*	probably null	Het
Ttn	T	C	2: 76,730,022	E29345G	probably damaging	Het
Usp33	T	A	3: 152,379,586	S620T	probably benign	Het
Vipr1	G	A	9: 121,668,474	G353R	probably damaging	Het
Vipr1	G	T	9: 121,668,475	G353V	probably damaging	Het
Ylpm1	T	A	12: 85,015,418	S240T	probably damaging	Het
Zfp772	A	G	7: 7,203,630	I354T	probably benign	Het
Zfp959	T	A	17: 55,897,231	Y86*	probably null	Het

Other mutations in Vps13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vps13c	APN	9	67945999	missense	probably benign	0.20
IGL00336:Vps13c	APN	9	67945942	missense	probably benign	0.01
IGL00418:Vps13c	APN	9	67876262	missense	probably damaging	1.00
IGL00481:Vps13c	APN	9	67860865	missense	probably damaging	1.00
IGL00491:Vps13c	APN	9	67893136	missense	probably damaging	1.00
IGL00558:Vps13c	APN	9	67937857	missense	possibly damaging	0.52
IGL00811:Vps13c	APN	9	67948181	missense	probably damaging	0.99
IGL01011:Vps13c	APN	9	67926955	missense	probably damaging	0.98
IGL01094:Vps13c	APN	9	67886284	missense	probably damaging	1.00
IGL01330:Vps13c	APN	9	67964108	missense	probably damaging	1.00
IGL01402:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01404:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01470:Vps13c	APN	9	67912927	splice site	probably benign
IGL01615:Vps13c	APN	9	67955781	missense	probably benign	0.01
IGL01694:Vps13c	APN	9	67895349	missense	probably damaging	1.00
IGL01752:Vps13c	APN	9	67948228	missense	probably damaging	1.00
IGL01810:Vps13c	APN	9	67955780	missense	probably benign
IGL01954:Vps13c	APN	9	67969298	missense	probably damaging	0.98
IGL01978:Vps13c	APN	9	67930643	missense	probably benign	0.03
IGL01998:Vps13c	APN	9	67955068	splice site	probably null
IGL02201:Vps13c	APN	9	67967136	missense	probably damaging	1.00
IGL02205:Vps13c	APN	9	67883454	missense	probably damaging	1.00
IGL02303:Vps13c	APN	9	67945481	splice site	probably benign
IGL02322:Vps13c	APN	9	67937901	missense	probably benign	0.02
IGL02456:Vps13c	APN	9	67952976	missense	probably damaging	1.00
IGL02474:Vps13c	APN	9	67937876	missense	probably benign	0.00
IGL02547:Vps13c	APN	9	67908019	missense	possibly damaging	0.83
IGL02640:Vps13c	APN	9	67886248	splice site	probably benign
IGL02673:Vps13c	APN	9	67878098	missense	probably damaging	1.00
IGL02721:Vps13c	APN	9	67964149	splice site	probably benign
IGL02834:Vps13c	APN	9	67937855	missense	probably benign
IGL02838:Vps13c	APN	9	67975851	missense	probably damaging	1.00
IGL03136:Vps13c	APN	9	67950310	missense	probably damaging	1.00
IGL03137:Vps13c	APN	9	67890380	missense	probably damaging	1.00
IGL03214:Vps13c	APN	9	67897195	missense	probably null	0.81
IGL03240:Vps13c	APN	9	67955047	missense	probably benign
IGL03303:Vps13c	APN	9	67934504	missense	probably benign	0.27
IGL03336:Vps13c	APN	9	67951642	missense	possibly damaging	0.76
IGL03366:Vps13c	APN	9	67946026	missense	probably benign	0.00
3-1:Vps13c	UTSW	9	67936373	missense	probably benign	0.00
IGL02991:Vps13c	UTSW	9	67913877	missense	probably damaging	1.00
PIT4802001:Vps13c	UTSW	9	67937786	missense	probably damaging	1.00
R0008:Vps13c	UTSW	9	67919262	missense	probably benign
R0206:Vps13c	UTSW	9	67939162	splice site	probably benign
R0288:Vps13c	UTSW	9	67927366	missense	probably damaging	0.99
R0324:Vps13c	UTSW	9	67964309	missense	possibly damaging	0.95
R0347:Vps13c	UTSW	9	67910233	missense	possibly damaging	0.93
R0374:Vps13c	UTSW	9	67886246	splice site	probably benign
R0388:Vps13c	UTSW	9	67922915	splice site	probably benign
R0409:Vps13c	UTSW	9	67951644	missense	probably benign	0.00
R0440:Vps13c	UTSW	9	67972861	missense	probably damaging	1.00
R0513:Vps13c	UTSW	9	67930735	missense	probably benign	0.02
R0520:Vps13c	UTSW	9	67945851	missense	possibly damaging	0.88
R0569:Vps13c	UTSW	9	67973719	missense	probably damaging	0.98
R0601:Vps13c	UTSW	9	67927472	missense	probably benign	0.12
R0659:Vps13c	UTSW	9	67920935	missense	probably benign	0.11
R0667:Vps13c	UTSW	9	67951573	nonsense	probably null
R0670:Vps13c	UTSW	9	67925857	missense	probably benign	0.35
R0698:Vps13c	UTSW	9	67889723	missense	probably benign	0.45
R0729:Vps13c	UTSW	9	67961649	missense	probably damaging	1.00
R0781:Vps13c	UTSW	9	67972003	missense	probably damaging	1.00
R0811:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0812:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0839:Vps13c	UTSW	9	67898738	missense	probably benign
R1373:Vps13c	UTSW	9	67927511	missense	probably damaging	0.99
R1396:Vps13c	UTSW	9	67955022	missense	probably benign	0.00
R1499:Vps13c	UTSW	9	67957505	missense	probably benign	0.00
R1556:Vps13c	UTSW	9	67930711	missense	probably damaging	0.98
R1560:Vps13c	UTSW	9	67936463	critical splice donor site	probably null
R1584:Vps13c	UTSW	9	67893112	missense	possibly damaging	0.74
R1654:Vps13c	UTSW	9	67951687	missense	probably damaging	1.00
R1674:Vps13c	UTSW	9	67853703	nonsense	probably null
R1676:Vps13c	UTSW	9	67926962	missense	probably benign	0.20
R1695:Vps13c	UTSW	9	67972075	nonsense	probably null
R1710:Vps13c	UTSW	9	67911529	missense	probably benign	0.00
R1769:Vps13c	UTSW	9	67965721	missense	probably benign	0.00
R1775:Vps13c	UTSW	9	67881447	missense	probably damaging	1.00
R1795:Vps13c	UTSW	9	67893985	nonsense	probably null
R1799:Vps13c	UTSW	9	67944117	missense	probably damaging	0.98
R1835:Vps13c	UTSW	9	67993013	missense	probably benign	0.08
R1848:Vps13c	UTSW	9	67936340	missense	probably benign
R1903:Vps13c	UTSW	9	67894052	missense	probably damaging	1.00
R1944:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1951:Vps13c	UTSW	9	67973759	critical splice donor site	probably null
R1993:Vps13c	UTSW	9	67975856	missense	probably damaging	1.00
R2023:Vps13c	UTSW	9	67936285	splice site	probably benign
R2059:Vps13c	UTSW	9	67860833	missense	probably damaging	1.00
R2086:Vps13c	UTSW	9	67950289	missense	probably benign	0.29
R2120:Vps13c	UTSW	9	67919334	missense	possibly damaging	0.92
R2249:Vps13c	UTSW	9	67988053	critical splice donor site	probably null
R2257:Vps13c	UTSW	9	67952946	missense	possibly damaging	0.87
R2258:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2259:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2260:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2265:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2266:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2269:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2278:Vps13c	UTSW	9	67939072	missense	probably benign
R2306:Vps13c	UTSW	9	67987993	missense	probably damaging	0.99
R2327:Vps13c	UTSW	9	67913820	missense	probably damaging	0.98
R2349:Vps13c	UTSW	9	67957526	missense	possibly damaging	0.89
R2483:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3031:Vps13c	UTSW	9	67923770	missense	probably benign	0.00
R3623:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3870:Vps13c	UTSW	9	67884726	missense	probably benign	0.00
R4173:Vps13c	UTSW	9	67936313	missense	probably benign	0.00
R4445:Vps13c	UTSW	9	67982495	splice site	probably null
R4491:Vps13c	UTSW	9	67910193	missense	probably benign
R4505:Vps13c	UTSW	9	67939034	missense	probably benign	0.02
R4574:Vps13c	UTSW	9	67951683	missense	probably damaging	1.00
R4691:Vps13c	UTSW	9	67952935	missense	possibly damaging	0.95
R4766:Vps13c	UTSW	9	67878224	splice site	probably null
R4771:Vps13c	UTSW	9	67929539	missense	probably benign
R4801:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4802:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4962:Vps13c	UTSW	9	67873891	missense	probably damaging	1.00
R4995:Vps13c	UTSW	9	67919321	missense	probably benign	0.00
R5010:Vps13c	UTSW	9	67916379	missense	probably benign	0.19
R5183:Vps13c	UTSW	9	67908052	missense	probably damaging	1.00
R5226:Vps13c	UTSW	9	67945553	missense	probably benign	0.17
R5297:Vps13c	UTSW	9	67878131	missense	probably damaging	1.00
R5456:Vps13c	UTSW	9	67927447	missense	possibly damaging	0.53
R5494:Vps13c	UTSW	9	67948146	missense	probably benign	0.00
R5521:Vps13c	UTSW	9	67951439	missense	probably benign	0.08
R5524:Vps13c	UTSW	9	67957556	missense	probably damaging	1.00
R5685:Vps13c	UTSW	9	67963173	missense	possibly damaging	0.64
R5731:Vps13c	UTSW	9	67895379	missense	probably damaging	1.00
R5812:Vps13c	UTSW	9	67982495	splice site	probably benign
R5867:Vps13c	UTSW	9	67982622	splice site	probably null
R5893:Vps13c	UTSW	9	67902839	critical splice acceptor site	probably null
R5902:Vps13c	UTSW	9	67934447	missense	probably benign	0.00
R5957:Vps13c	UTSW	9	67954971	missense	probably damaging	1.00
R6076:Vps13c	UTSW	9	67911602	missense	probably damaging	1.00
R6187:Vps13c	UTSW	9	67915657	missense	probably damaging	1.00
R6268:Vps13c	UTSW	9	67951449	missense	probably benign	0.10
R6547:Vps13c	UTSW	9	67973365	missense	probably damaging	1.00
R6716:Vps13c	UTSW	9	67951467	missense	probably benign	0.00
R6837:Vps13c	UTSW	9	67910222	missense	probably benign
R6919:Vps13c	UTSW	9	67927452	missense	probably damaging	0.97
R7039:Vps13c	UTSW	9	67937763	missense	probably damaging	1.00
R7058:Vps13c	UTSW	9	67923828	missense	probably benign	0.39
R7082:Vps13c	UTSW	9	67883453	missense	probably damaging	1.00
R7195:Vps13c	UTSW	9	67945825	missense	possibly damaging	0.95
R7244:Vps13c	UTSW	9	67889804	missense	probably benign	0.00
R7300:Vps13c	UTSW	9	67940544	missense	probably benign	0.20
R7314:Vps13c	UTSW	9	67943340	splice site	probably null
R7352:Vps13c	UTSW	9	67840446	missense	possibly damaging	0.94
R7368:Vps13c	UTSW	9	67914073	missense	probably benign	0.23
R7411:Vps13c	UTSW	9	67972001	missense	probably damaging	0.98
R7497:Vps13c	UTSW	9	67840479	missense	probably damaging	1.00
R7516:Vps13c	UTSW	9	67955007	missense	possibly damaging	0.89
R7638:Vps13c	UTSW	9	67945509	missense	probably damaging	1.00
R7732:Vps13c	UTSW	9	67940516	missense	probably damaging	0.97
R7748:Vps13c	UTSW	9	67963089	missense	probably benign	0.03
R7779:Vps13c	UTSW	9	67881422	missense	probably damaging	1.00
R7788:Vps13c	UTSW	9	67940483	missense	probably benign	0.01
R7894:Vps13c	UTSW	9	67926983	missense	probably damaging	0.99
R8163:Vps13c	UTSW	9	67950438	missense	probably benign	0.08
R8165:Vps13c	UTSW	9	67858790	missense	probably benign	0.00
R8202:Vps13c	UTSW	9	67944046	missense	probably damaging	0.98
R8235:Vps13c	UTSW	9	67927396	missense	probably damaging	1.00
R8235:Vps13c	UTSW	9	67955781	missense	probably benign	0.01
R8253:Vps13c	UTSW	9	67943488	nonsense	probably null
R8261:Vps13c	UTSW	9	67954980	missense	probably damaging	1.00
R8348:Vps13c	UTSW	9	67879103	missense	possibly damaging	0.79
R8547:Vps13c	UTSW	9	67945566	missense	probably damaging	1.00
U24488:Vps13c	UTSW	9	67905916	missense	probably benign	0.13
X0021:Vps13c	UTSW	9	67937781	missense	probably damaging	0.99
X0058:Vps13c	UTSW	9	67927419	missense	probably damaging	1.00
X0065:Vps13c	UTSW	9	67873863	missense	probably damaging	1.00
Z1088:Vps13c	UTSW	9	67913975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGATGTATTTATGTCCGTAGTGC -3'
(R):5'- GAATAGCACGTGCCTGATGC -3'

Sequencing Primer
(F):5'- TATGTCCGTAGTGCAGCGGC -3'
(R):5'- GCTGAAGGTTAACTGACAGTTCC -3'

Posted On

2014-08-01