Incidental Mutation 'R1945:Amotl2'
ID216581
Institutional Source Beutler Lab
Gene Symbol Amotl2
Ensembl Gene ENSMUSG00000032531
Gene Nameangiomotin-like 2
SynonymsLccp, MASCOT
MMRRC Submission 039963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R1945 (G1)
Quality Score82
Status Not validated
Chromosome9
Chromosomal Location102716672-102733418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102720554 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 171 (S171P)
Ref Sequence ENSEMBL: ENSMUSP00000121113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035121] [ENSMUST00000134483] [ENSMUST00000142011] [ENSMUST00000145913] [ENSMUST00000145937] [ENSMUST00000153911] [ENSMUST00000153965] [ENSMUST00000156485] [ENSMUST00000190047]
Predicted Effect probably benign
Transcript: ENSMUST00000035121
AA Change: S138P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035121
Gene: ENSMUSG00000032531
AA Change: S138P

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 688 2.3e-98 PFAM
low complexity region 698 710 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130602
SMART Domains Protein: ENSMUSP00000115845
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 30 50 N/A INTRINSIC
Blast:PAC 134 175 8e-13 BLAST
low complexity region 204 218 N/A INTRINSIC
Pfam:Angiomotin_C 260 470 4.9e-98 PFAM
low complexity region 480 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138224
Predicted Effect probably benign
Transcript: ENSMUST00000142011
AA Change: S138P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120378
Gene: ENSMUSG00000032531
AA Change: S138P

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 686 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145913
AA Change: S138P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118126
Gene: ENSMUSG00000032531
AA Change: S138P

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145937
SMART Domains Protein: ENSMUSP00000114950
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153911
AA Change: S161P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119903
Gene: ENSMUSG00000032531
AA Change: S161P

DomainStartEndE-ValueType
low complexity region 56 76 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153965
AA Change: S171P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121113
Gene: ENSMUSG00000032531
AA Change: S171P

DomainStartEndE-ValueType
low complexity region 66 86 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 190 203 N/A INTRINSIC
low complexity region 225 248 N/A INTRINSIC
low complexity region 281 301 N/A INTRINSIC
Blast:PAC 385 426 1e-12 BLAST
low complexity region 455 469 N/A INTRINSIC
Pfam:Angiomotin_C 511 719 3.7e-94 PFAM
low complexity region 731 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155143
Predicted Effect probably benign
Transcript: ENSMUST00000156485
SMART Domains Protein: ENSMUSP00000116554
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190047
SMART Domains Protein: ENSMUSP00000140688
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
coiled coil region 1 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiomotin is a protein that binds angiostatin, a circulating inhibitor of the formation of new blood vessels (angiogenesis). Angiomotin mediates angiostatin inhibition of endothelial cell migration and tube formation in vitro. The protein encoded by this gene is related to angiomotin and is a member of the motin protein family. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Conditional homozygous knockout in endothelial cells during embryonic development leads to aortic restriction in the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,768,483 E585V probably damaging Het
4930562C15Rik A G 16: 4,835,685 I33V unknown Het
4931408C20Rik C A 1: 26,682,314 V1262F probably benign Het
Abca1 ACGTCTTCACCAGGTAATC AC 4: 53,061,509 probably null Het
Atf6 A T 1: 170,855,141 V34E probably benign Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bglap A G 3: 88,383,664 Y87H probably damaging Het
Camk2n1 G A 4: 138,456,783 V78I possibly damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Cdc14b T C 13: 64,219,890 Y208C probably damaging Het
Cdc42bpb C T 12: 111,299,133 R1455Q probably damaging Het
Cep170 C A 1: 176,793,534 G26* probably null Het
Cfap46 A G 7: 139,679,903 F217S probably damaging Het
Col11a2 A T 17: 34,059,168 D691V probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Coq8b CGCA CGCAGCA 7: 27,233,980 probably benign Het
Coq8b GCA GCAACA 7: 27,233,981 probably benign Het
Dcaf5 T C 12: 80,338,694 D886G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
Etaa1 A G 11: 17,947,233 C295R probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Ghdc C T 11: 100,769,205 A239T probably benign Het
Gm906 C T 13: 50,245,491 G933E probably damaging Het
Grik4 T C 9: 42,521,004 D899G possibly damaging Het
Hacd2 C A 16: 35,101,984 T181K possibly damaging Het
Havcr2 T C 11: 46,455,050 L17P unknown Het
Herc3 T C 6: 58,887,439 V686A probably damaging Het
Hyal3 T C 9: 107,585,472 L235P probably damaging Het
Itgb4 C T 11: 115,993,453 Q988* probably null Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Lama1 T A 17: 67,745,853 S394T probably benign Het
Lamp1 T C 8: 13,172,545 V243A probably benign Het
Loxhd1 A G 18: 77,404,808 Y1315C probably damaging Het
Macf1 A T 4: 123,490,660 L1148* probably null Het
Mill2 A G 7: 18,841,494 H42R probably benign Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Myo15b A T 11: 115,878,398 I1472F probably damaging Het
Nasp T C 4: 116,622,768 S36G possibly damaging Het
Nav2 A G 7: 49,464,872 Y868C probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Npc1l1 C T 11: 6,225,199 W592* probably null Het
Nsg2 T C 11: 32,055,068 V90A probably damaging Het
Odf4 T C 11: 68,922,157 N225S possibly damaging Het
Olfr1230 T C 2: 89,296,784 Y162C probably damaging Het
Olfr340 T C 2: 36,453,031 W149R probably damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pcdhb4 A T 18: 37,308,868 R410S probably damaging Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pik3ap1 A T 19: 41,274,337 S799T probably benign Het
Pitx2 A G 3: 129,218,536 N198S probably damaging Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Recql5 G A 11: 115,928,297 R148* probably null Het
Reep3 A G 10: 67,035,899 S97P probably damaging Het
Rnase12 T A 14: 51,057,006 Q72L possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Scn10a A T 9: 119,691,454 S127T possibly damaging Het
Scn7a A T 2: 66,675,980 W1522R probably damaging Het
Senp7 A G 16: 56,123,946 H211R probably damaging Het
Sept10 C T 10: 59,181,019 probably null Het
Serpinb6d T C 13: 33,667,680 V140A possibly damaging Het
Sned1 A G 1: 93,271,238 E457G probably benign Het
Spag17 A C 3: 99,939,982 M76L probably benign Het
Ssfa2 T C 2: 79,662,652 V1181A probably benign Het
Sspo A T 6: 48,489,773 E105V possibly damaging Het
Stoml3 T A 3: 53,505,445 D173E possibly damaging Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Svil T C 18: 5,117,059 W2165R probably damaging Het
Tbl2 T A 5: 135,157,600 S184T possibly damaging Het
Tdrd7 A T 4: 45,965,474 T31S probably benign Het
Tmeff1 A G 4: 48,614,960 N139S possibly damaging Het
Trip13 T C 13: 73,927,924 R199G probably damaging Het
Tshb G T 3: 102,777,515 Y124* probably null Het
Ttn T C 2: 76,730,022 E29345G probably damaging Het
Usp33 T A 3: 152,379,586 S620T probably benign Het
Vipr1 G A 9: 121,668,474 G353R probably damaging Het
Vipr1 G T 9: 121,668,475 G353V probably damaging Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Ylpm1 T A 12: 85,015,418 S240T probably damaging Het
Zfp772 A G 7: 7,203,630 I354T probably benign Het
Zfp959 T A 17: 55,897,231 Y86* probably null Het
Other mutations in Amotl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Amotl2 APN 9 102725117 missense probably damaging 1.00
IGL02207:Amotl2 APN 9 102724697 missense probably damaging 1.00
R0471:Amotl2 UTSW 9 102720519 missense probably damaging 0.98
R1420:Amotl2 UTSW 9 102724783 missense possibly damaging 0.91
R1483:Amotl2 UTSW 9 102730897 missense probably benign 0.16
R1525:Amotl2 UTSW 9 102728568 missense probably damaging 1.00
R1661:Amotl2 UTSW 9 102730096 missense probably damaging 0.99
R2113:Amotl2 UTSW 9 102724723 nonsense probably null
R2157:Amotl2 UTSW 9 102730589 unclassified probably benign
R4084:Amotl2 UTSW 9 102724685 critical splice acceptor site probably null
R4726:Amotl2 UTSW 9 102723819 missense probably benign 0.00
R4755:Amotl2 UTSW 9 102720480 missense probably damaging 1.00
R4782:Amotl2 UTSW 9 102720123 critical splice donor site probably null
R4819:Amotl2 UTSW 9 102730071 missense probably damaging 1.00
R5048:Amotl2 UTSW 9 102723798 missense probably benign 0.00
R5328:Amotl2 UTSW 9 102723768 missense probably benign
R5894:Amotl2 UTSW 9 102725172 missense possibly damaging 0.79
R6956:Amotl2 UTSW 9 102724768 missense probably damaging 1.00
R7304:Amotl2 UTSW 9 102728350 missense probably damaging 1.00
R7390:Amotl2 UTSW 9 102731690 missense probably damaging 1.00
R7474:Amotl2 UTSW 9 102730111 missense probably benign 0.00
R7816:Amotl2 UTSW 9 102731654 missense probably benign 0.43
X0022:Amotl2 UTSW 9 102729470 missense probably damaging 1.00
Z1088:Amotl2 UTSW 9 102723698 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCCTTGGAGATCGGAGCAC -3'
(R):5'- GTATCTTGGGTCAGTGACAGC -3'

Sequencing Primer
(F):5'- ACAGTCAGGTGCTGCAGC -3'
(R):5'- GCAGTCTCCTGAGCCATTACAG -3'
Posted On2014-08-01