Incidental Mutation 'R1945:4930562C15Rik'
ID216622
Institutional Source Beutler Lab
Gene Symbol 4930562C15Rik
Ensembl Gene ENSMUSG00000022518
Gene NameRIKEN cDNA 4930562C15 gene
Synonyms
MMRRC Submission 039963-MU
Accession Numbers

Ncbi RefSeq: NM_030192.1; MGI:1926059

Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1945 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4835416-4867686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4835685 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 33 (I33V)
Ref Sequence ENSEMBL: ENSMUSP00000097784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100211] [ENSMUST00000177042]
Predicted Effect unknown
Transcript: ENSMUST00000100211
AA Change: I33V
SMART Domains Protein: ENSMUSP00000097784
Gene: ENSMUSG00000022518
AA Change: I33V

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
coiled coil region 181 211 N/A INTRINSIC
internal_repeat_1 289 315 2.54e-5 PROSPERO
internal_repeat_1 314 341 2.54e-5 PROSPERO
low complexity region 360 377 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
low complexity region 573 604 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
Pfam:DUF4795 745 960 1.7e-46 PFAM
low complexity region 1095 1109 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177042
SMART Domains Protein: ENSMUSP00000135160
Gene: ENSMUSG00000022518

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
coiled coil region 181 211 N/A INTRINSIC
internal_repeat_1 289 315 2.39e-6 PROSPERO
internal_repeat_1 314 341 2.39e-6 PROSPERO
low complexity region 360 377 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
internal_repeat_2 470 523 5.51e-5 PROSPERO
internal_repeat_2 514 568 5.51e-5 PROSPERO
low complexity region 573 604 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
coiled coil region 781 799 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,768,483 E585V probably damaging Het
4931408C20Rik C A 1: 26,682,314 V1262F probably benign Het
Abca1 ACGTCTTCACCAGGTAATC AC 4: 53,061,509 probably null Het
Amotl2 T C 9: 102,720,554 S171P probably benign Het
Atf6 A T 1: 170,855,141 V34E probably benign Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bglap A G 3: 88,383,664 Y87H probably damaging Het
Camk2n1 G A 4: 138,456,783 V78I possibly damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Cdc14b T C 13: 64,219,890 Y208C probably damaging Het
Cdc42bpb C T 12: 111,299,133 R1455Q probably damaging Het
Cep170 C A 1: 176,793,534 G26* probably null Het
Cfap46 A G 7: 139,679,903 F217S probably damaging Het
Col11a2 A T 17: 34,059,168 D691V probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Coq8b CGCA CGCAGCA 7: 27,233,980 probably benign Het
Coq8b GCA GCAACA 7: 27,233,981 probably benign Het
Dcaf5 T C 12: 80,338,694 D886G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
Etaa1 A G 11: 17,947,233 C295R probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Ghdc C T 11: 100,769,205 A239T probably benign Het
Gm906 C T 13: 50,245,491 G933E probably damaging Het
Grik4 T C 9: 42,521,004 D899G possibly damaging Het
Hacd2 C A 16: 35,101,984 T181K possibly damaging Het
Havcr2 T C 11: 46,455,050 L17P unknown Het
Herc3 T C 6: 58,887,439 V686A probably damaging Het
Hyal3 T C 9: 107,585,472 L235P probably damaging Het
Itgb4 C T 11: 115,993,453 Q988* probably null Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Lama1 T A 17: 67,745,853 S394T probably benign Het
Lamp1 T C 8: 13,172,545 V243A probably benign Het
Loxhd1 A G 18: 77,404,808 Y1315C probably damaging Het
Macf1 A T 4: 123,490,660 L1148* probably null Het
Mill2 A G 7: 18,841,494 H42R probably benign Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Myo15b A T 11: 115,878,398 I1472F probably damaging Het
Nasp T C 4: 116,622,768 S36G possibly damaging Het
Nav2 A G 7: 49,464,872 Y868C probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Npc1l1 C T 11: 6,225,199 W592* probably null Het
Nsg2 T C 11: 32,055,068 V90A probably damaging Het
Odf4 T C 11: 68,922,157 N225S possibly damaging Het
Olfr1230 T C 2: 89,296,784 Y162C probably damaging Het
Olfr340 T C 2: 36,453,031 W149R probably damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pcdhb4 A T 18: 37,308,868 R410S probably damaging Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pik3ap1 A T 19: 41,274,337 S799T probably benign Het
Pitx2 A G 3: 129,218,536 N198S probably damaging Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Recql5 G A 11: 115,928,297 R148* probably null Het
Reep3 A G 10: 67,035,899 S97P probably damaging Het
Rnase12 T A 14: 51,057,006 Q72L possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Scn10a A T 9: 119,691,454 S127T possibly damaging Het
Scn7a A T 2: 66,675,980 W1522R probably damaging Het
Senp7 A G 16: 56,123,946 H211R probably damaging Het
Sept10 C T 10: 59,181,019 probably null Het
Serpinb6d T C 13: 33,667,680 V140A possibly damaging Het
Sned1 A G 1: 93,271,238 E457G probably benign Het
Spag17 A C 3: 99,939,982 M76L probably benign Het
Ssfa2 T C 2: 79,662,652 V1181A probably benign Het
Sspo A T 6: 48,489,773 E105V possibly damaging Het
Stoml3 T A 3: 53,505,445 D173E possibly damaging Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Svil T C 18: 5,117,059 W2165R probably damaging Het
Tbl2 T A 5: 135,157,600 S184T possibly damaging Het
Tdrd7 A T 4: 45,965,474 T31S probably benign Het
Tmeff1 A G 4: 48,614,960 N139S possibly damaging Het
Trip13 T C 13: 73,927,924 R199G probably damaging Het
Tshb G T 3: 102,777,515 Y124* probably null Het
Ttn T C 2: 76,730,022 E29345G probably damaging Het
Usp33 T A 3: 152,379,586 S620T probably benign Het
Vipr1 G A 9: 121,668,474 G353R probably damaging Het
Vipr1 G T 9: 121,668,475 G353V probably damaging Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Ylpm1 T A 12: 85,015,418 S240T probably damaging Het
Zfp772 A G 7: 7,203,630 I354T probably benign Het
Zfp959 T A 17: 55,897,231 Y86* probably null Het
Other mutations in 4930562C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:4930562C15Rik APN 16 4864646 missense probably benign 0.31
IGL01610:4930562C15Rik APN 16 4851565 splice site probably benign
IGL02869:4930562C15Rik APN 16 4867459 missense possibly damaging 0.68
IGL03242:4930562C15Rik APN 16 4849325 missense unknown
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0063:4930562C15Rik UTSW 16 4861048 nonsense probably null
R0083:4930562C15Rik UTSW 16 4849542 missense unknown
R0565:4930562C15Rik UTSW 16 4864336 missense probably benign 0.22
R0630:4930562C15Rik UTSW 16 4850939 missense possibly damaging 0.90
R0734:4930562C15Rik UTSW 16 4850334 missense probably benign 0.01
R1200:4930562C15Rik UTSW 16 4849672 missense unknown
R1738:4930562C15Rik UTSW 16 4864611 missense probably damaging 1.00
R1775:4930562C15Rik UTSW 16 4851558 unclassified probably null
R2132:4930562C15Rik UTSW 16 4835971 missense unknown
R2445:4930562C15Rik UTSW 16 4864397 splice site probably null
R2696:4930562C15Rik UTSW 16 4850364 missense probably benign 0.04
R4729:4930562C15Rik UTSW 16 4849323 missense unknown
R4779:4930562C15Rik UTSW 16 4849749 missense unknown
R4806:4930562C15Rik UTSW 16 4849672 missense unknown
R4808:4930562C15Rik UTSW 16 4849672 missense unknown
R4876:4930562C15Rik UTSW 16 4849672 missense unknown
R4931:4930562C15Rik UTSW 16 4861046 missense possibly damaging 0.47
R4956:4930562C15Rik UTSW 16 4854952 missense probably damaging 0.99
R5085:4930562C15Rik UTSW 16 4835973 nonsense probably null
R5203:4930562C15Rik UTSW 16 4835598 missense unknown
R5229:4930562C15Rik UTSW 16 4850051 missense possibly damaging 0.73
R5461:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5462:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5464:4930562C15Rik UTSW 16 4864363 missense probably damaging 1.00
R5595:4930562C15Rik UTSW 16 4864279 missense probably benign 0.01
R6054:4930562C15Rik UTSW 16 4835865 missense unknown
R6405:4930562C15Rik UTSW 16 4851878 missense probably damaging 0.97
R6859:4930562C15Rik UTSW 16 4851935 missense possibly damaging 0.86
R7124:4930562C15Rik UTSW 16 4864332 missense probably benign 0.02
R7139:4930562C15Rik UTSW 16 4850184 missense probably benign 0.00
R7182:4930562C15Rik UTSW 16 4849714 missense unknown
R7219:4930562C15Rik UTSW 16 4849644 missense unknown
R7366:4930562C15Rik UTSW 16 4835769 missense unknown
R7592:4930562C15Rik UTSW 16 4849274 missense unknown
R7759:4930562C15Rik UTSW 16 4864650 missense probably benign 0.01
R7789:4930562C15Rik UTSW 16 4864311 missense probably benign 0.01
X0028:4930562C15Rik UTSW 16 4867367 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTTGCTGACCACTGTGACTTG -3'
(R):5'- TTCGATTCGGTCTACTACTTGG -3'

Sequencing Primer
(F):5'- AAGCCTCTCAGGACCTGTTG -3'
(R):5'- GGTCAAAGATGTTGCTAAGCCTC -3'
Posted On2014-08-01