Incidental Mutation 'R1945:Col11a2'
ID216625
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
MMRRC Submission 039963-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R1945 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34059168 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 691 (D691V)
Ref Sequence ENSEMBL: ENSMUSP00000115026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000143354]
Predicted Effect probably damaging
Transcript: ENSMUST00000087497
AA Change: D999V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: D999V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114252
AA Change: D1004V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: D1004V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114255
AA Change: D1038V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: D1038V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137374
Predicted Effect probably damaging
Transcript: ENSMUST00000143354
AA Change: D691V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330
AA Change: D691V

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173749
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,768,483 E585V probably damaging Het
4930562C15Rik A G 16: 4,835,685 I33V unknown Het
4931408C20Rik C A 1: 26,682,314 V1262F probably benign Het
Abca1 ACGTCTTCACCAGGTAATC AC 4: 53,061,509 probably null Het
Amotl2 T C 9: 102,720,554 S171P probably benign Het
Atf6 A T 1: 170,855,141 V34E probably benign Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bglap A G 3: 88,383,664 Y87H probably damaging Het
Camk2n1 G A 4: 138,456,783 V78I possibly damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Cdc14b T C 13: 64,219,890 Y208C probably damaging Het
Cdc42bpb C T 12: 111,299,133 R1455Q probably damaging Het
Cep170 C A 1: 176,793,534 G26* probably null Het
Cfap46 A G 7: 139,679,903 F217S probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Coq8b CGCA CGCAGCA 7: 27,233,980 probably benign Het
Coq8b GCA GCAACA 7: 27,233,981 probably benign Het
Dcaf5 T C 12: 80,338,694 D886G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
Etaa1 A G 11: 17,947,233 C295R probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Ghdc C T 11: 100,769,205 A239T probably benign Het
Gm906 C T 13: 50,245,491 G933E probably damaging Het
Grik4 T C 9: 42,521,004 D899G possibly damaging Het
Hacd2 C A 16: 35,101,984 T181K possibly damaging Het
Havcr2 T C 11: 46,455,050 L17P unknown Het
Herc3 T C 6: 58,887,439 V686A probably damaging Het
Hyal3 T C 9: 107,585,472 L235P probably damaging Het
Itgb4 C T 11: 115,993,453 Q988* probably null Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Lama1 T A 17: 67,745,853 S394T probably benign Het
Lamp1 T C 8: 13,172,545 V243A probably benign Het
Loxhd1 A G 18: 77,404,808 Y1315C probably damaging Het
Macf1 A T 4: 123,490,660 L1148* probably null Het
Mill2 A G 7: 18,841,494 H42R probably benign Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Myo15b A T 11: 115,878,398 I1472F probably damaging Het
Nasp T C 4: 116,622,768 S36G possibly damaging Het
Nav2 A G 7: 49,464,872 Y868C probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Npc1l1 C T 11: 6,225,199 W592* probably null Het
Nsg2 T C 11: 32,055,068 V90A probably damaging Het
Odf4 T C 11: 68,922,157 N225S possibly damaging Het
Olfr1230 T C 2: 89,296,784 Y162C probably damaging Het
Olfr340 T C 2: 36,453,031 W149R probably damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pcdhb4 A T 18: 37,308,868 R410S probably damaging Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pik3ap1 A T 19: 41,274,337 S799T probably benign Het
Pitx2 A G 3: 129,218,536 N198S probably damaging Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Recql5 G A 11: 115,928,297 R148* probably null Het
Reep3 A G 10: 67,035,899 S97P probably damaging Het
Rnase12 T A 14: 51,057,006 Q72L possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Scn10a A T 9: 119,691,454 S127T possibly damaging Het
Scn7a A T 2: 66,675,980 W1522R probably damaging Het
Senp7 A G 16: 56,123,946 H211R probably damaging Het
Sept10 C T 10: 59,181,019 probably null Het
Serpinb6d T C 13: 33,667,680 V140A possibly damaging Het
Sned1 A G 1: 93,271,238 E457G probably benign Het
Spag17 A C 3: 99,939,982 M76L probably benign Het
Ssfa2 T C 2: 79,662,652 V1181A probably benign Het
Sspo A T 6: 48,489,773 E105V possibly damaging Het
Stoml3 T A 3: 53,505,445 D173E possibly damaging Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Svil T C 18: 5,117,059 W2165R probably damaging Het
Tbl2 T A 5: 135,157,600 S184T possibly damaging Het
Tdrd7 A T 4: 45,965,474 T31S probably benign Het
Tmeff1 A G 4: 48,614,960 N139S possibly damaging Het
Trip13 T C 13: 73,927,924 R199G probably damaging Het
Tshb G T 3: 102,777,515 Y124* probably null Het
Ttn T C 2: 76,730,022 E29345G probably damaging Het
Usp33 T A 3: 152,379,586 S620T probably benign Het
Vipr1 G A 9: 121,668,474 G353R probably damaging Het
Vipr1 G T 9: 121,668,475 G353V probably damaging Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Ylpm1 T A 12: 85,015,418 S240T probably damaging Het
Zfp772 A G 7: 7,203,630 I354T probably benign Het
Zfp959 T A 17: 55,897,231 Y86* probably null Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
PIT4531001:Col11a2 UTSW 17 34046438 critical splice acceptor site probably null
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0005:Col11a2 UTSW 17 34062879 unclassified probably benign
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0352:Col11a2 UTSW 17 34042527 missense probably benign 0.43
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0491:Col11a2 UTSW 17 34042212 missense probably null 0.00
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4810:Col11a2 UTSW 17 34057112 missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5534:Col11a2 UTSW 17 34051024 missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
R6992:Col11a2 UTSW 17 34047144 missense probably benign 0.01
R7292:Col11a2 UTSW 17 34051508 missense unknown
R7543:Col11a2 UTSW 17 34050456 missense unknown
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTGAGGAGTAATGGCTACCAAG -3'
(R):5'- CAGCGTCGTGGATACTTACATG -3'

Sequencing Primer
(F):5'- AATGGCTACCAAGGTGTTTTTG -3'
(R):5'- GCGTCGTGGATACTTACATGTTCAC -3'
Posted On2014-08-01