Incidental Mutation 'R1946:Sulf1'
ID216638
Institutional Source Beutler Lab
Gene Symbol Sulf1
Ensembl Gene ENSMUSG00000016918
Gene Namesulfatase 1
Synonyms
MMRRC Submission 039964-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R1946 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location12692277-12861192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12796907 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 105 (V105A)
Ref Sequence ENSEMBL: ENSMUSP00000136014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051]
Predicted Effect probably benign
Transcript: ENSMUST00000088585
AA Change: V105A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918
AA Change: V105A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177608
AA Change: V105A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918
AA Change: V105A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 534 678 9.7e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180062
AA Change: V105A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918
AA Change: V105A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186051
AA Change: V105A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918
AA Change: V105A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.4e-56 PFAM
Pfam:Phosphodiest 61 323 9.6e-8 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 1.1e-48 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187376
Meta Mutation Damage Score 0.2688 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adamts5 C A 16: 85,899,243 C342F probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Aen G C 7: 78,902,672 E32Q probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgap44 A G 11: 65,012,096 M509T probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
Bmpr2 T C 1: 59,868,397 V883A possibly damaging Het
Bpifa1 A T 2: 154,145,634 I135F probably damaging Het
Bsn A G 9: 108,114,651 F1301L probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Ccdc18 A G 5: 108,228,995 E1434G probably damaging Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Cpn1 G A 19: 43,956,518 T450M probably benign Het
Dlg4 A G 11: 70,039,575 Y432C probably damaging Het
Dnah8 C A 17: 30,712,385 T1458K probably benign Het
Dock5 A T 14: 67,786,316 M1132K probably damaging Het
Dsg2 A G 18: 20,580,548 D192G probably damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fndc11 A T 2: 181,221,834 D144V probably benign Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Ganab T A 19: 8,910,808 D439E probably damaging Het
Gm10228 C A 16: 89,041,353 G21V unknown Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gm9573 A T 17: 35,622,524 probably benign Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Gsdmc4 C A 15: 63,902,780 D51Y probably benign Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Kcnq2 T A 2: 181,088,451 D446V probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Lrrcc1 A G 3: 14,550,393 R394G probably benign Het
Lrrk2 G A 15: 91,736,661 probably null Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Msrb3 A G 10: 120,852,008 V54A probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Ncor2 G A 5: 125,034,412 T1314I probably damaging Het
Nes A G 3: 87,978,514 Q1316R possibly damaging Het
Nfe2l3 A C 6: 51,457,315 Q285P probably damaging Het
Nkd1 C T 8: 88,592,117 H357Y probably damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Olfr1333 T C 4: 118,830,026 N139S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr1469 T C 19: 13,410,779 V70A possibly damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Otx1 G T 11: 21,998,482 T46K probably damaging Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Pcdhb16 T A 18: 37,478,899 L304* probably null Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Ppp1r12b A G 1: 134,892,270 V245A probably damaging Het
Ppp2r2d A G 7: 138,868,467 D19G probably damaging Het
Rimbp3 G A 16: 17,210,427 V572I probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Syngr3 T C 17: 24,687,706 N45S probably benign Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Usf2 T C 7: 30,956,238 T1A probably null Het
Vill A T 9: 119,058,492 H108L probably benign Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Zfp24 AC A 18: 24,014,419 probably null Het
Other mutations in Sulf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Sulf1 APN 1 12820463 missense probably damaging 0.99
IGL00788:Sulf1 APN 1 12848449 missense probably damaging 0.99
IGL00845:Sulf1 APN 1 12796967 missense probably damaging 1.00
IGL01606:Sulf1 APN 1 12836204 missense possibly damaging 0.87
IGL01963:Sulf1 APN 1 12818507 missense probably damaging 1.00
IGL01968:Sulf1 APN 1 12818451 missense probably damaging 1.00
IGL02072:Sulf1 APN 1 12848208 missense probably damaging 1.00
IGL02424:Sulf1 APN 1 12796840 missense probably benign 0.28
IGL02519:Sulf1 APN 1 12838363 nonsense probably null
IGL02601:Sulf1 APN 1 12786645 missense probably damaging 1.00
IGL03066:Sulf1 APN 1 12807944 missense probably damaging 0.99
IGL03200:Sulf1 APN 1 12786617 nonsense probably null
PIT4480001:Sulf1 UTSW 1 12859413 missense probably benign 0.01
PIT4519001:Sulf1 UTSW 1 12848171 missense probably damaging 1.00
R0083:Sulf1 UTSW 1 12817417 missense probably damaging 0.99
R0467:Sulf1 UTSW 1 12796920 missense probably damaging 1.00
R0554:Sulf1 UTSW 1 12805194 missense probably damaging 1.00
R0626:Sulf1 UTSW 1 12817492 splice site probably null
R1083:Sulf1 UTSW 1 12836164 frame shift probably null
R1084:Sulf1 UTSW 1 12836164 frame shift probably null
R1498:Sulf1 UTSW 1 12848350 missense probably damaging 1.00
R1523:Sulf1 UTSW 1 12817350 nonsense probably null
R1854:Sulf1 UTSW 1 12838437 missense probably benign 0.06
R1942:Sulf1 UTSW 1 12848173 missense probably damaging 1.00
R1998:Sulf1 UTSW 1 12858834 nonsense probably null
R2034:Sulf1 UTSW 1 12820421 missense probably damaging 1.00
R2068:Sulf1 UTSW 1 12840403 missense probably damaging 1.00
R2113:Sulf1 UTSW 1 12848174 missense probably damaging 0.99
R2277:Sulf1 UTSW 1 12796794 missense probably benign 0.41
R3827:Sulf1 UTSW 1 12817432 missense probably benign
R3874:Sulf1 UTSW 1 12817412 missense probably damaging 1.00
R4488:Sulf1 UTSW 1 12786515 start gained probably benign
R4619:Sulf1 UTSW 1 12786652 missense probably damaging 1.00
R4743:Sulf1 UTSW 1 12836293 missense probably benign 0.04
R4836:Sulf1 UTSW 1 12842686 missense probably benign 0.02
R4918:Sulf1 UTSW 1 12818496 missense probably damaging 1.00
R4958:Sulf1 UTSW 1 12796910 missense probably benign 0.08
R5216:Sulf1 UTSW 1 12796874 missense probably benign 0.28
R5225:Sulf1 UTSW 1 12841478 missense probably benign
R5427:Sulf1 UTSW 1 12796912 missense possibly damaging 0.84
R5450:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R5909:Sulf1 UTSW 1 12858815 missense possibly damaging 0.94
R5912:Sulf1 UTSW 1 12786752 unclassified probably benign
R5966:Sulf1 UTSW 1 12859412 missense probably benign 0.06
R6339:Sulf1 UTSW 1 12838440 missense probably damaging 1.00
R6841:Sulf1 UTSW 1 12838434 missense probably damaging 1.00
R6880:Sulf1 UTSW 1 12842755 missense probably damaging 1.00
R7110:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R7255:Sulf1 UTSW 1 12859008 missense probably benign 0.00
R7275:Sulf1 UTSW 1 12850965 utr 3 prime probably null
R7386:Sulf1 UTSW 1 12838361 missense probably benign 0.07
R7611:Sulf1 UTSW 1 12836243 missense probably benign
R7732:Sulf1 UTSW 1 12842789 missense probably benign 0.11
R7796:Sulf1 UTSW 1 12858820 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGGGAACAGCGCTATCTAAATG -3'
(R):5'- GTTGAGTCTCCTGGAACTTCTC -3'

Sequencing Primer
(F):5'- CAGCGCTATCTAAATGACTTATGG -3'
(R):5'- AGTTCCCCTCATCTGAGA -3'
Posted On2014-08-01