Mutagenetix > Incidental Mutation

Incidental Mutation 'R1946:Ncoa3'

216651

Institutional Source

Beutler Lab

Gene Symbol

Ncoa3

Ensembl Gene

ENSMUSG00000027678

Gene Name

nuclear receptor coactivator 3

Synonyms

TRAM-1, RAC3, AIB1, Src3, KAT13B, TRAM1, pCIP, bHLHe42, 2010305B15Rik

MMRRC Submission

039964-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R1946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

165992636-166073242 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 166059177 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 896 (N896K)

Ref Sequence

ENSEMBL: ENSMUSP00000104875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088095] [ENSMUST00000109252]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088095
AA Change: N896K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: N896K

Domain	Start	End	E-Value	Type
HLH	32	89	5.63e-9	SMART
PAS	113	179	1.16e-11	SMART
Pfam:PAS_11	261	372	1.6e-34	PFAM
Pfam:NCOA_u2	451	564	7.1e-46	PFAM
low complexity region	586	599	N/A	INTRINSIC
Pfam:SRC-1	608	696	1.6e-32	PFAM
Pfam:DUF4927	714	801	2e-32	PFAM
coiled coil region	960	997	N/A	INTRINSIC
Pfam:Nuc_rec_co-act	1056	1104	2.1e-27	PFAM
low complexity region	1180	1197	N/A	INTRINSIC
low complexity region	1221	1233	N/A	INTRINSIC
low complexity region	1243	1263	N/A	INTRINSIC
DUF1518	1270	1327	1.08e-21	SMART
low complexity region	1384	1398	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109252
AA Change: N896K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: N896K

Domain	Start	End	E-Value	Type
HLH	32	89	5.63e-9	SMART
PAS	113	179	1.16e-11	SMART
Pfam:PAS_11	261	372	4.1e-34	PFAM
low complexity region	438	467	N/A	INTRINSIC
low complexity region	502	522	N/A	INTRINSIC
low complexity region	527	535	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC
Pfam:SRC-1	608	696	3.5e-28	PFAM
coiled coil region	960	997	N/A	INTRINSIC
Pfam:Nuc_rec_co-act	1056	1106	6.6e-29	PFAM
low complexity region	1180	1197	N/A	INTRINSIC
low complexity region	1218	1232	N/A	INTRINSIC
low complexity region	1242	1262	N/A	INTRINSIC
DUF1518	1269	1326	1.08e-21	SMART
low complexity region	1383	1397	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139658

Meta Mutation Damage Score

0.0671

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adamts5	C	A	16: 85,899,243	C342F	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Aen	G	C	7: 78,902,672	E32Q	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgap44	A	G	11: 65,012,096	M509T	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
Bmpr2	T	C	1: 59,868,397	V883A	possibly damaging	Het
Bpifa1	A	T	2: 154,145,634	I135F	probably damaging	Het
Bsn	A	G	9: 108,114,651	F1301L	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Ccdc18	A	G	5: 108,228,995	E1434G	probably damaging	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Cpn1	G	A	19: 43,956,518	T450M	probably benign	Het
Dlg4	A	G	11: 70,039,575	Y432C	probably damaging	Het
Dnah8	C	A	17: 30,712,385	T1458K	probably benign	Het
Dock5	A	T	14: 67,786,316	M1132K	probably damaging	Het
Dsg2	A	G	18: 20,580,548	D192G	probably damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fndc11	A	T	2: 181,221,834	D144V	probably benign	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Ganab	T	A	19: 8,910,808	D439E	probably damaging	Het
Gm10228	C	A	16: 89,041,353	G21V	unknown	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gm9573	A	T	17: 35,622,524		probably benign	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Gsdmc4	C	A	15: 63,902,780	D51Y	probably benign	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Kcnq2	T	A	2: 181,088,451	D446V	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Lrrcc1	A	G	3: 14,550,393	R394G	probably benign	Het
Lrrk2	G	A	15: 91,736,661		probably null	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Msrb3	A	G	10: 120,852,008	V54A	probably damaging	Het
Ncor2	G	A	5: 125,034,412	T1314I	probably damaging	Het
Nes	A	G	3: 87,978,514	Q1316R	possibly damaging	Het
Nfe2l3	A	C	6: 51,457,315	Q285P	probably damaging	Het
Nkd1	C	T	8: 88,592,117	H357Y	probably damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Olfr1333	T	C	4: 118,830,026	N139S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr1469	T	C	19: 13,410,779	V70A	possibly damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Otx1	G	T	11: 21,998,482	T46K	probably damaging	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Pcdhb16	T	A	18: 37,478,899	L304*	probably null	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Ppp1r12b	A	G	1: 134,892,270	V245A	probably damaging	Het
Ppp2r2d	A	G	7: 138,868,467	D19G	probably damaging	Het
Rimbp3	G	A	16: 17,210,427	V572I	probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Syngr3	T	C	17: 24,687,706	N45S	probably benign	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Usf2	T	C	7: 30,956,238	T1A	probably null	Het
Vill	A	T	9: 119,058,492	H108L	probably benign	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het
Zfp24	AC	A	18: 24,014,419		probably null	Het

Other mutations in Ncoa3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Ncoa3	APN	2	166051609	splice site	probably null
IGL01068:Ncoa3	APN	2	166052795	missense	probably damaging	1.00
IGL01300:Ncoa3	APN	2	166068461	missense	probably benign	0.41
IGL01336:Ncoa3	APN	2	166054523	missense	probably benign
IGL01533:Ncoa3	APN	2	166055025	missense	probably benign	0.03
IGL01658:Ncoa3	APN	2	166051302	splice site	probably benign
IGL02053:Ncoa3	APN	2	166054834	missense	probably damaging	1.00
IGL02138:Ncoa3	APN	2	166055262	missense	probably benign
IGL02167:Ncoa3	APN	2	166070136	missense	probably damaging	1.00
IGL02217:Ncoa3	APN	2	166055346	missense	probably damaging	1.00
IGL02312:Ncoa3	APN	2	166057200	missense	probably benign	0.10
IGL02381:Ncoa3	APN	2	166052817	missense	probably damaging	1.00
IGL02568:Ncoa3	APN	2	166069357	missense	probably damaging	1.00
IGL02658:Ncoa3	APN	2	166051393	missense	probably benign	0.01
IGL02806:Ncoa3	APN	2	166052432	missense	probably benign	0.25
R0054:Ncoa3	UTSW	2	166055178	missense	possibly damaging	0.67
R0054:Ncoa3	UTSW	2	166055178	missense	possibly damaging	0.67
R0240:Ncoa3	UTSW	2	166054400	missense	probably benign
R0240:Ncoa3	UTSW	2	166054400	missense	probably benign
R0333:Ncoa3	UTSW	2	166054291	missense	probably damaging	1.00
R0379:Ncoa3	UTSW	2	166054502	missense	probably damaging	0.97
R0411:Ncoa3	UTSW	2	166068543	missense	probably benign	0.31
R0734:Ncoa3	UTSW	2	166069191	unclassified	probably benign
R1434:Ncoa3	UTSW	2	166055510	missense	probably benign	0.01
R1491:Ncoa3	UTSW	2	166055262	missense	probably benign
R1721:Ncoa3	UTSW	2	166069301	missense	possibly damaging	0.55
R1895:Ncoa3	UTSW	2	166059177	missense	possibly damaging	0.68
R1896:Ncoa3	UTSW	2	166048464	missense	probably benign	0.36
R2406:Ncoa3	UTSW	2	166055359	missense	probably damaging	1.00
R3800:Ncoa3	UTSW	2	166059719	missense	possibly damaging	0.58
R3825:Ncoa3	UTSW	2	166054798	missense	possibly damaging	0.83
R4377:Ncoa3	UTSW	2	166054497	missense	possibly damaging	0.50
R4674:Ncoa3	UTSW	2	166059811	missense	probably benign
R4706:Ncoa3	UTSW	2	166047879	missense	probably damaging	1.00
R4751:Ncoa3	UTSW	2	166069903	missense	possibly damaging	0.81
R4954:Ncoa3	UTSW	2	166065786	missense	probably benign
R4976:Ncoa3	UTSW	2	166047900	missense	probably damaging	1.00
R4992:Ncoa3	UTSW	2	166069939	missense	probably benign	0.39
R5100:Ncoa3	UTSW	2	166050097	missense	probably damaging	1.00
R5578:Ncoa3	UTSW	2	166054328	missense	probably benign	0.00
R5932:Ncoa3	UTSW	2	166070125	splice site	probably null
R6051:Ncoa3	UTSW	2	166058765	missense	probably damaging	1.00
R6370:Ncoa3	UTSW	2	166065905	missense	probably benign	0.00
R6372:Ncoa3	UTSW	2	166059347	missense	possibly damaging	0.94
R6373:Ncoa3	UTSW	2	166059347	missense	possibly damaging	0.94
R7438:Ncoa3	UTSW	2	166068529	missense	probably damaging	1.00
R7660:Ncoa3	UTSW	2	166069321	missense	probably benign	0.00
R7738:Ncoa3	UTSW	2	166050067	missense	probably damaging	1.00
R7752:Ncoa3	UTSW	2	166065768	nonsense	probably null
R7970:Ncoa3	UTSW	2	166051357	missense	probably benign	0.01
R8829:Ncoa3	UTSW	2	166050148	missense	probably damaging	1.00
R9133:Ncoa3	UTSW	2	166068461	missense	possibly damaging	0.92
R9625:Ncoa3	UTSW	2	166057210	missense	probably benign
X0018:Ncoa3	UTSW	2	166054802	missense	possibly damaging	0.58
Z1177:Ncoa3	UTSW	2	166048508	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCCGTTGGTTCAGAACACC -3'
(R):5'- CACCTGGCAGTCGATTAGAACG -3'

Sequencing Primer
(F):5'- GTTGGTTCAGAACACCTTTCTAAC -3'
(R):5'- CTGGCAGTCGATTAGAACGAAGTG -3'

Posted On

2014-08-01