Mutagenetix > Incidental Mutations

Incidental Mutation 'R1946:Sec24d'

216657

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

MMRRC Submission

039964-MU

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123353394 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 667 (H667L)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

probably benign
Transcript: ENSMUST00000047923
AA Change: H667L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: H667L

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200309

Meta Mutation Damage Score

0.1381

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adamts5	C	A	16: 85,899,243	C342F	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Aen	G	C	7: 78,902,672	E32Q	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgap44	A	G	11: 65,012,096	M509T	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
Bmpr2	T	C	1: 59,868,397	V883A	possibly damaging	Het
Bpifa1	A	T	2: 154,145,634	I135F	probably damaging	Het
Bsn	A	G	9: 108,114,651	F1301L	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Ccdc18	A	G	5: 108,228,995	E1434G	probably damaging	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Cpn1	G	A	19: 43,956,518	T450M	probably benign	Het
Dlg4	A	G	11: 70,039,575	Y432C	probably damaging	Het
Dnah8	C	A	17: 30,712,385	T1458K	probably benign	Het
Dock5	A	T	14: 67,786,316	M1132K	probably damaging	Het
Dsg2	A	G	18: 20,580,548	D192G	probably damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fndc11	A	T	2: 181,221,834	D144V	probably benign	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Ganab	T	A	19: 8,910,808	D439E	probably damaging	Het
Gm10228	C	A	16: 89,041,353	G21V	unknown	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gm9573	A	T	17: 35,622,524		probably benign	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Gsdmc4	C	A	15: 63,902,780	D51Y	probably benign	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Kcnq2	T	A	2: 181,088,451	D446V	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Lrrcc1	A	G	3: 14,550,393	R394G	probably benign	Het
Lrrk2	G	A	15: 91,736,661		probably null	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Msrb3	A	G	10: 120,852,008	V54A	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Ncor2	G	A	5: 125,034,412	T1314I	probably damaging	Het
Nes	A	G	3: 87,978,514	Q1316R	possibly damaging	Het
Nfe2l3	A	C	6: 51,457,315	Q285P	probably damaging	Het
Nkd1	C	T	8: 88,592,117	H357Y	probably damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Olfr1333	T	C	4: 118,830,026	N139S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr1469	T	C	19: 13,410,779	V70A	possibly damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Otx1	G	T	11: 21,998,482	T46K	probably damaging	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Pcdhb16	T	A	18: 37,478,899	L304*	probably null	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Ppp1r12b	A	G	1: 134,892,270	V245A	probably damaging	Het
Ppp2r2d	A	G	7: 138,868,467	D19G	probably damaging	Het
Rimbp3	G	A	16: 17,210,427	V572I	probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Syngr3	T	C	17: 24,687,706	N45S	probably benign	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Usf2	T	C	7: 30,956,238	T1A	probably null	Het
Vill	A	T	9: 119,058,492	H108L	probably benign	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het
Zfp24	AC	A	18: 24,014,419		probably null	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8922:Sec24d	UTSW	3	123350839	missense	probably damaging	1.00
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9015:Sec24d	UTSW	3	123327638	missense	probably benign	0.43
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCCATCCAAAGGTTATGAAGTG -3'
(R):5'- GGGACAAAGGAAGATTTGCCTC -3'

Sequencing Primer
(F):5'- AAGAGTCACACTGCCAAAGATTATG -3'
(R):5'- GACAAAGGAAGATTTGCCTCTTCTTC -3'

Posted On

2014-08-01