Incidental Mutation 'R1946:Grm3'
ID216660
Institutional Source Beutler Lab
Gene Symbol Grm3
Ensembl Gene ENSMUSG00000003974
Gene Nameglutamate receptor, metabotropic 3
SynonymsGprc1c, mGlu3, mGluR3, 0710001G23Rik
MMRRC Submission 039964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1946 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location9485541-9725170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9512123 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 576 (W576R)
Ref Sequence ENSEMBL: ENSMUSP00000004076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004076]
Predicted Effect probably damaging
Transcript: ENSMUST00000004076
AA Change: W576R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004076
Gene: ENSMUSG00000003974
AA Change: W576R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 67 473 4.8e-102 PFAM
Pfam:NCD3G 505 555 2.4e-14 PFAM
Pfam:7tm_3 588 825 4.7e-62 PFAM
low complexity region 849 861 N/A INTRINSIC
Meta Mutation Damage Score 0.442 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a knock-out allele exhibit altered neuroprotection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adamts5 C A 16: 85,899,243 C342F probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Aen G C 7: 78,902,672 E32Q probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgap44 A G 11: 65,012,096 M509T probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
Bmpr2 T C 1: 59,868,397 V883A possibly damaging Het
Bpifa1 A T 2: 154,145,634 I135F probably damaging Het
Bsn A G 9: 108,114,651 F1301L probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Ccdc18 A G 5: 108,228,995 E1434G probably damaging Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Cpn1 G A 19: 43,956,518 T450M probably benign Het
Dlg4 A G 11: 70,039,575 Y432C probably damaging Het
Dnah8 C A 17: 30,712,385 T1458K probably benign Het
Dock5 A T 14: 67,786,316 M1132K probably damaging Het
Dsg2 A G 18: 20,580,548 D192G probably damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fndc11 A T 2: 181,221,834 D144V probably benign Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Ganab T A 19: 8,910,808 D439E probably damaging Het
Gm10228 C A 16: 89,041,353 G21V unknown Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gm9573 A T 17: 35,622,524 probably benign Het
Gsdmc4 C A 15: 63,902,780 D51Y probably benign Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Kcnq2 T A 2: 181,088,451 D446V probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Lrrcc1 A G 3: 14,550,393 R394G probably benign Het
Lrrk2 G A 15: 91,736,661 probably null Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Msrb3 A G 10: 120,852,008 V54A probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Ncor2 G A 5: 125,034,412 T1314I probably damaging Het
Nes A G 3: 87,978,514 Q1316R possibly damaging Het
Nfe2l3 A C 6: 51,457,315 Q285P probably damaging Het
Nkd1 C T 8: 88,592,117 H357Y probably damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Olfr1333 T C 4: 118,830,026 N139S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr1469 T C 19: 13,410,779 V70A possibly damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Otx1 G T 11: 21,998,482 T46K probably damaging Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Pcdhb16 T A 18: 37,478,899 L304* probably null Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Ppp1r12b A G 1: 134,892,270 V245A probably damaging Het
Ppp2r2d A G 7: 138,868,467 D19G probably damaging Het
Rimbp3 G A 16: 17,210,427 V572I probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Syngr3 T C 17: 24,687,706 N45S probably benign Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Usf2 T C 7: 30,956,238 T1A probably null Het
Vill A T 9: 119,058,492 H108L probably benign Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Zfp24 AC A 18: 24,014,419 probably null Het
Other mutations in Grm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Grm3 APN 5 9512290 missense probably benign
IGL01393:Grm3 APN 5 9589856 missense probably benign 0.00
IGL01398:Grm3 APN 5 9485762 unclassified probably benign
IGL01825:Grm3 APN 5 9511600 missense probably damaging 1.00
IGL01966:Grm3 APN 5 9511486 missense probably damaging 0.98
IGL02367:Grm3 APN 5 9511660 missense probably damaging 1.00
IGL02526:Grm3 APN 5 9589847 missense probably damaging 1.00
IGL02972:Grm3 APN 5 9512410 missense probably damaging 1.00
IGL03356:Grm3 APN 5 9512206 missense possibly damaging 0.89
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0389:Grm3 UTSW 5 9504794 missense probably damaging 1.00
R0455:Grm3 UTSW 5 9512477 missense probably benign
R0538:Grm3 UTSW 5 9512446 missense possibly damaging 0.95
R0553:Grm3 UTSW 5 9570048 missense probably benign 0.16
R1124:Grm3 UTSW 5 9570297 missense probably benign
R1163:Grm3 UTSW 5 9570738 missense probably benign 0.34
R1440:Grm3 UTSW 5 9589958 missense probably benign
R1635:Grm3 UTSW 5 9511520 missense probably damaging 1.00
R1734:Grm3 UTSW 5 9589742 missense probably benign 0.00
R1895:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R1926:Grm3 UTSW 5 9504881 missense probably damaging 0.98
R1940:Grm3 UTSW 5 9511682 missense probably damaging 1.00
R2004:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2005:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2006:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R3116:Grm3 UTSW 5 9570752 missense probably damaging 1.00
R4083:Grm3 UTSW 5 9512054 missense probably benign
R4537:Grm3 UTSW 5 9512083 missense probably benign 0.02
R4855:Grm3 UTSW 5 9570047 missense probably damaging 0.98
R5060:Grm3 UTSW 5 9570167 missense probably damaging 0.99
R5093:Grm3 UTSW 5 9589766 missense probably benign 0.01
R5419:Grm3 UTSW 5 9570233 missense probably damaging 1.00
R5525:Grm3 UTSW 5 9504872 missense probably damaging 1.00
R5642:Grm3 UTSW 5 9570536 missense probably benign 0.21
R5804:Grm3 UTSW 5 9570155 missense probably benign 0.33
R5915:Grm3 UTSW 5 9511927 missense probably damaging 1.00
R5966:Grm3 UTSW 5 9511930 missense probably damaging 0.98
R6151:Grm3 UTSW 5 9511556 missense probably damaging 1.00
R6419:Grm3 UTSW 5 9570201 missense probably damaging 1.00
R7267:Grm3 UTSW 5 9589581 missense probably benign 0.00
R7555:Grm3 UTSW 5 9570000 missense probably benign 0.00
X0020:Grm3 UTSW 5 9512195 missense probably damaging 1.00
X0025:Grm3 UTSW 5 9485790 missense probably damaging 1.00
X0026:Grm3 UTSW 5 9512238 nonsense probably null
Z1088:Grm3 UTSW 5 9570183 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGACAGGCGATGGCTTAG -3'
(R):5'- ACTTCCCAGTGCAGTGATCC -3'

Sequencing Primer
(F):5'- CAGGCGATGGCTTAGCAATG -3'
(R):5'- AGTGCAGTGATCCCTGTGC -3'
Posted On2014-08-01