Mutagenetix > Incidental Mutation

Incidental Mutation 'R1946:Fut2'

216678

Institutional Source

Beutler Lab

Gene Symbol

Fut2

Ensembl Gene

ENSMUSG00000055978

Gene Name

fucosyltransferase 2

Synonyms

MMRRC Submission

039964-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45648591-45666394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45651324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 8 (F8S)

Ref Sequence

ENSEMBL: ENSMUSP00000147471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]

AlphaFold

Q9JL27

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069800
AA Change: F8S

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: F8S

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_11	21	338	2.1e-139	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000210620
AA Change: F8S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210988

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211324

Meta Mutation Damage Score

0.2348

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adamts5	C	A	16: 85,899,243	C342F	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Aen	G	C	7: 78,902,672	E32Q	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgap44	A	G	11: 65,012,096	M509T	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
Bmpr2	T	C	1: 59,868,397	V883A	possibly damaging	Het
Bpifa1	A	T	2: 154,145,634	I135F	probably damaging	Het
Bsn	A	G	9: 108,114,651	F1301L	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Ccdc18	A	G	5: 108,228,995	E1434G	probably damaging	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Cpn1	G	A	19: 43,956,518	T450M	probably benign	Het
Dlg4	A	G	11: 70,039,575	Y432C	probably damaging	Het
Dnah8	C	A	17: 30,712,385	T1458K	probably benign	Het
Dock5	A	T	14: 67,786,316	M1132K	probably damaging	Het
Dsg2	A	G	18: 20,580,548	D192G	probably damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fndc11	A	T	2: 181,221,834	D144V	probably benign	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Ganab	T	A	19: 8,910,808	D439E	probably damaging	Het
Gm10228	C	A	16: 89,041,353	G21V	unknown	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gm9573	A	T	17: 35,622,524		probably benign	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Gsdmc4	C	A	15: 63,902,780	D51Y	probably benign	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Kcnq2	T	A	2: 181,088,451	D446V	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Lrrcc1	A	G	3: 14,550,393	R394G	probably benign	Het
Lrrk2	G	A	15: 91,736,661		probably null	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Msrb3	A	G	10: 120,852,008	V54A	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Ncor2	G	A	5: 125,034,412	T1314I	probably damaging	Het
Nes	A	G	3: 87,978,514	Q1316R	possibly damaging	Het
Nfe2l3	A	C	6: 51,457,315	Q285P	probably damaging	Het
Nkd1	C	T	8: 88,592,117	H357Y	probably damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Olfr1333	T	C	4: 118,830,026	N139S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr1469	T	C	19: 13,410,779	V70A	possibly damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Otx1	G	T	11: 21,998,482	T46K	probably damaging	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Pcdhb16	T	A	18: 37,478,899	L304*	probably null	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Ppp1r12b	A	G	1: 134,892,270	V245A	probably damaging	Het
Ppp2r2d	A	G	7: 138,868,467	D19G	probably damaging	Het
Rimbp3	G	A	16: 17,210,427	V572I	probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Syngr3	T	C	17: 24,687,706	N45S	probably benign	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Usf2	T	C	7: 30,956,238	T1A	probably null	Het
Vill	A	T	9: 119,058,492	H108L	probably benign	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het
Zfp24	AC	A	18: 24,014,419		probably null	Het

Other mutations in Fut2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02814:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL02831:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL02982:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03071:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03090:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03126:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03146:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03151:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03179:Fut2	APN	7	45650649	missense	probably benign	0.02
IGL03212:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03213:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03234:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03271:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03372:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03381:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03385:Fut2	APN	7	45650769	missense	possibly damaging	0.94
IGL03392:Fut2	APN	7	45650769	missense	possibly damaging	0.94
PIT4515001:Fut2	UTSW	7	45650466	missense	probably damaging	1.00
R0553:Fut2	UTSW	7	45651274	missense	probably damaging	1.00
R1895:Fut2	UTSW	7	45651324	missense	probably damaging	1.00
R2347:Fut2	UTSW	7	45650328	missense	probably damaging	0.99
R3155:Fut2	UTSW	7	45650667	missense	probably damaging	1.00
R3156:Fut2	UTSW	7	45650667	missense	probably damaging	1.00
R4590:Fut2	UTSW	7	45650946	missense	possibly damaging	0.64
R6311:Fut2	UTSW	7	45650380	missense	possibly damaging	0.46
R6810:Fut2	UTSW	7	45650505	missense	probably damaging	1.00
R6965:Fut2	UTSW	7	45650881	missense	probably damaging	1.00
R8135:Fut2	UTSW	7	45651142	missense	probably damaging	1.00
R9087:Fut2	UTSW	7	45651069	missense	probably damaging	1.00
R9097:Fut2	UTSW	7	45650951	missense	probably benign	0.01
R9462:Fut2	UTSW	7	45651068	missense	probably damaging	1.00
X0066:Fut2	UTSW	7	45650374	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAATATGCCCTGCAGCTTGG -3'
(R):5'- GCCACACAGTTTCCAGCTAG -3'

Sequencing Primer
(F):5'- TGGCACTCTGCTGCATG -3'
(R):5'- GCTAGACTAAGCTATGGCATGAAATC -3'

Posted On

2014-08-01