Mutagenetix > Incidental Mutations

Incidental Mutation 'R1946:Apba2'

216680

Institutional Source

Beutler Lab

Gene Symbol

Apba2

Ensembl Gene

ENSMUSG00000030519

Gene Name

amyloid beta (A4) precursor protein-binding, family A, member 2

Synonyms

X11L, X11-like, Mint 2

MMRRC Submission

039964-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R1946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64501706-64753878 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 64744630 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246] [ENSMUST00000206246]

Predicted Effect

probably null
Transcript: ENSMUST00000032732

SMART Domains

Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519

Domain	Start	End	E-Value	Type
low complexity region	82	96	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
PTB	368	534	6.31e-29	SMART
PDZ	578	656	6.32e-12	SMART
PDZ	670	736	1.79e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000096173

SMART Domains

Protein: ENSMUSP00000093887
Gene: ENSMUSG00000030519

Domain	Start	End	E-Value	Type
PDZ	27	105	6.32e-12	SMART
PDZ	119	185	1.79e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000107507

SMART Domains

Protein: ENSMUSP00000103131
Gene: ENSMUSG00000030519

Domain	Start	End	E-Value	Type
low complexity region	82	96	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
PTB	368	522	8.46e-30	SMART
PDZ	566	644	6.32e-12	SMART
PDZ	658	724	1.79e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205551

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206061

Predicted Effect

probably null
Transcript: ENSMUST00000206246

Predicted Effect

probably null
Transcript: ENSMUST00000206246

Predicted Effect

probably null
Transcript: ENSMUST00000206630

Predicted Effect

probably null
Transcript: ENSMUST00000206630

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adamts5	C	A	16: 85,899,243	C342F	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Aen	G	C	7: 78,902,672	E32Q	probably damaging	Het
Arhgap44	A	G	11: 65,012,096	M509T	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
Bmpr2	T	C	1: 59,868,397	V883A	possibly damaging	Het
Bpifa1	A	T	2: 154,145,634	I135F	probably damaging	Het
Bsn	A	G	9: 108,114,651	F1301L	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Ccdc18	A	G	5: 108,228,995	E1434G	probably damaging	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Cpn1	G	A	19: 43,956,518	T450M	probably benign	Het
Dlg4	A	G	11: 70,039,575	Y432C	probably damaging	Het
Dnah8	C	A	17: 30,712,385	T1458K	probably benign	Het
Dock5	A	T	14: 67,786,316	M1132K	probably damaging	Het
Dsg2	A	G	18: 20,580,548	D192G	probably damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fndc11	A	T	2: 181,221,834	D144V	probably benign	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Ganab	T	A	19: 8,910,808	D439E	probably damaging	Het
Gm10228	C	A	16: 89,041,353	G21V	unknown	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gm9573	A	T	17: 35,622,524		probably benign	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Gsdmc4	C	A	15: 63,902,780	D51Y	probably benign	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Kcnq2	T	A	2: 181,088,451	D446V	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Lrrcc1	A	G	3: 14,550,393	R394G	probably benign	Het
Lrrk2	G	A	15: 91,736,661		probably null	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Msrb3	A	G	10: 120,852,008	V54A	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Ncor2	G	A	5: 125,034,412	T1314I	probably damaging	Het
Nes	A	G	3: 87,978,514	Q1316R	possibly damaging	Het
Nfe2l3	A	C	6: 51,457,315	Q285P	probably damaging	Het
Nkd1	C	T	8: 88,592,117	H357Y	probably damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Olfr1333	T	C	4: 118,830,026	N139S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr1469	T	C	19: 13,410,779	V70A	possibly damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Otx1	G	T	11: 21,998,482	T46K	probably damaging	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Pcdhb16	T	A	18: 37,478,899	L304*	probably null	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Ppp1r12b	A	G	1: 134,892,270	V245A	probably damaging	Het
Ppp2r2d	A	G	7: 138,868,467	D19G	probably damaging	Het
Rimbp3	G	A	16: 17,210,427	V572I	probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Syngr3	T	C	17: 24,687,706	N45S	probably benign	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Usf2	T	C	7: 30,956,238	T1A	probably null	Het
Vill	A	T	9: 119,058,492	H108L	probably benign	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het
Zfp24	AC	A	18: 24,014,419		probably null	Het

Other mutations in Apba2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Apba2	APN	7	64736941	missense	possibly damaging	0.79
IGL01716:Apba2	APN	7	64745826	splice site	probably benign
IGL02218:Apba2	APN	7	64695677	missense	probably benign	0.01
IGL02343:Apba2	APN	7	64695146	missense	probably damaging	0.96
IGL03265:Apba2	APN	7	64695323	missense	probably damaging	1.00
guadalupe	UTSW	7	64750164	missense	probably damaging	1.00
LCD18:Apba2	UTSW	7	64622160	intron	probably benign
R0395:Apba2	UTSW	7	64743408	missense	probably benign	0.00
R0554:Apba2	UTSW	7	64745780	missense	probably damaging	1.00
R0624:Apba2	UTSW	7	64714515	splice site	probably null
R0733:Apba2	UTSW	7	64750164	missense	probably damaging	1.00
R1107:Apba2	UTSW	7	64745719	missense	possibly damaging	0.51
R1464:Apba2	UTSW	7	64695549	missense	probably benign
R1464:Apba2	UTSW	7	64695549	missense	probably benign
R1486:Apba2	UTSW	7	64736948	missense	probably damaging	1.00
R1895:Apba2	UTSW	7	64744630	critical splice donor site	probably null
R1942:Apba2	UTSW	7	64695470	missense	possibly damaging	0.92
R2002:Apba2	UTSW	7	64733542	missense	probably damaging	0.97
R2089:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2091:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2091:Apba2	UTSW	7	64695593	missense	probably benign	0.02
R2571:Apba2	UTSW	7	64745750	missense	probably damaging	0.98
R3035:Apba2	UTSW	7	64739792	missense	probably benign	0.03
R4620:Apba2	UTSW	7	64714467	missense	probably damaging	1.00
R5468:Apba2	UTSW	7	64745762	missense	probably damaging	1.00
R5478:Apba2	UTSW	7	64695186	nonsense	probably null
R5644:Apba2	UTSW	7	64715511	missense	probably benign
R5645:Apba2	UTSW	7	64695806	missense	possibly damaging	0.92
R5941:Apba2	UTSW	7	64745716	missense	probably benign	0.03
R5969:Apba2	UTSW	7	64744447	nonsense	probably null
R6190:Apba2	UTSW	7	64739880	missense	probably damaging	0.98
R6806:Apba2	UTSW	7	64695459	missense	probably damaging	1.00
R7098:Apba2	UTSW	7	64736948	missense	probably damaging	1.00
R7143:Apba2	UTSW	7	64744417	missense	probably damaging	1.00
R7183:Apba2	UTSW	7	64733545	missense	probably benign	0.11
R7260:Apba2	UTSW	7	64739745	missense	probably damaging	1.00
R7479:Apba2	UTSW	7	64739859	missense	possibly damaging	0.63
R7677:Apba2	UTSW	7	64695097	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGACCAAATCCCTCCTGTCAAG -3'
(R):5'- TGCCTGGAGTGAGATGACAC -3'

Sequencing Primer
(F):5'- AAGTGGGCCCTCTCACACTG -3'
(R):5'- GAGTGAGATGACACCTCCCTC -3'

Posted On

2014-08-01