Incidental Mutation 'R1946:Snx19'
ID216687
Institutional Source Beutler Lab
Gene Symbol Snx19
Ensembl Gene ENSMUSG00000031993
Gene Namesorting nexin 19
Synonyms3526401K03Rik
MMRRC Submission 039964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1946 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location30427108-30466733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30432324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 593 (N593K)
Ref Sequence ENSEMBL: ENSMUSP00000131895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164099] [ENSMUST00000216545]
Predicted Effect probably damaging
Transcript: ENSMUST00000164099
AA Change: N593K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: N593K

DomainStartEndE-ValueType
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:PXA 96 269 2.9e-43 PFAM
low complexity region 324 335 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 504 528 N/A INTRINSIC
PX 533 664 1.83e-24 SMART
Pfam:Nexin_C 843 951 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216552
Meta Mutation Damage Score 0.4527 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adamts5 C A 16: 85,899,243 C342F probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Aen G C 7: 78,902,672 E32Q probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgap44 A G 11: 65,012,096 M509T probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
Bmpr2 T C 1: 59,868,397 V883A possibly damaging Het
Bpifa1 A T 2: 154,145,634 I135F probably damaging Het
Bsn A G 9: 108,114,651 F1301L probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Ccdc18 A G 5: 108,228,995 E1434G probably damaging Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Cpn1 G A 19: 43,956,518 T450M probably benign Het
Dlg4 A G 11: 70,039,575 Y432C probably damaging Het
Dnah8 C A 17: 30,712,385 T1458K probably benign Het
Dock5 A T 14: 67,786,316 M1132K probably damaging Het
Dsg2 A G 18: 20,580,548 D192G probably damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fndc11 A T 2: 181,221,834 D144V probably benign Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Ganab T A 19: 8,910,808 D439E probably damaging Het
Gm10228 C A 16: 89,041,353 G21V unknown Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gm9573 A T 17: 35,622,524 probably benign Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Gsdmc4 C A 15: 63,902,780 D51Y probably benign Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Kcnq2 T A 2: 181,088,451 D446V probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Lrrcc1 A G 3: 14,550,393 R394G probably benign Het
Lrrk2 G A 15: 91,736,661 probably null Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Msrb3 A G 10: 120,852,008 V54A probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Ncor2 G A 5: 125,034,412 T1314I probably damaging Het
Nes A G 3: 87,978,514 Q1316R possibly damaging Het
Nfe2l3 A C 6: 51,457,315 Q285P probably damaging Het
Nkd1 C T 8: 88,592,117 H357Y probably damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Olfr1333 T C 4: 118,830,026 N139S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr1469 T C 19: 13,410,779 V70A possibly damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Otx1 G T 11: 21,998,482 T46K probably damaging Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Pcdhb16 T A 18: 37,478,899 L304* probably null Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Ppp1r12b A G 1: 134,892,270 V245A probably damaging Het
Ppp2r2d A G 7: 138,868,467 D19G probably damaging Het
Rimbp3 G A 16: 17,210,427 V572I probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Syngr3 T C 17: 24,687,706 N45S probably benign Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Usf2 T C 7: 30,956,238 T1A probably null Het
Vill A T 9: 119,058,492 H108L probably benign Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Zfp24 AC A 18: 24,014,419 probably null Het
Other mutations in Snx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Snx19 APN 9 30429084 missense possibly damaging 0.92
IGL00498:Snx19 APN 9 30428937 missense possibly damaging 0.92
IGL00718:Snx19 APN 9 30432326 missense probably damaging 1.00
IGL00902:Snx19 APN 9 30428732 missense possibly damaging 0.90
IGL01433:Snx19 APN 9 30428771 missense possibly damaging 0.93
IGL01668:Snx19 APN 9 30427823 missense probably benign
IGL01732:Snx19 APN 9 30462353 missense probably damaging 1.00
IGL01767:Snx19 APN 9 30463264 missense possibly damaging 0.95
IGL02638:Snx19 APN 9 30432364 missense possibly damaging 0.52
IGL02718:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02719:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02723:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02724:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02725:Snx19 APN 9 30432260 missense possibly damaging 0.72
IGL02892:Snx19 APN 9 30428364 missense probably damaging 1.00
IGL03061:Snx19 APN 9 30433632 missense probably damaging 0.99
IGL03402:Snx19 APN 9 30440134 missense possibly damaging 0.89
R0125:Snx19 UTSW 9 30440219 missense probably damaging 1.00
R0133:Snx19 UTSW 9 30428616 missense possibly damaging 0.94
R0196:Snx19 UTSW 9 30433387 missense probably damaging 1.00
R0423:Snx19 UTSW 9 30435837 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428810 missense probably damaging 1.00
R0635:Snx19 UTSW 9 30428811 missense probably damaging 1.00
R1068:Snx19 UTSW 9 30429018 missense probably damaging 0.99
R1570:Snx19 UTSW 9 30428343 missense probably damaging 1.00
R1727:Snx19 UTSW 9 30433366 missense probably damaging 1.00
R1895:Snx19 UTSW 9 30432324 missense probably damaging 1.00
R1907:Snx19 UTSW 9 30433576 missense probably damaging 0.99
R1989:Snx19 UTSW 9 30428108 missense possibly damaging 0.93
R2029:Snx19 UTSW 9 30429000 missense probably benign 0.01
R2914:Snx19 UTSW 9 30433532 unclassified probably benign
R3880:Snx19 UTSW 9 30462392 missense probably damaging 1.00
R4223:Snx19 UTSW 9 30428448 missense possibly damaging 0.95
R4415:Snx19 UTSW 9 30437483 missense probably damaging 0.99
R4438:Snx19 UTSW 9 30428599 missense probably benign 0.01
R4484:Snx19 UTSW 9 30427896 missense probably benign 0.01
R4585:Snx19 UTSW 9 30440195 missense probably damaging 1.00
R4765:Snx19 UTSW 9 30440157 missense probably damaging 1.00
R4771:Snx19 UTSW 9 30433638 missense probably damaging 1.00
R4922:Snx19 UTSW 9 30437467 missense probably benign 0.25
R5096:Snx19 UTSW 9 30428786 missense probably benign 0.40
R5464:Snx19 UTSW 9 30427973 missense possibly damaging 0.54
R6469:Snx19 UTSW 9 30427743 missense possibly damaging 0.50
R6886:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R6988:Snx19 UTSW 9 30428935 missense probably damaging 1.00
R7131:Snx19 UTSW 9 30427893 missense probably damaging 1.00
R7268:Snx19 UTSW 9 30440177 missense probably damaging 1.00
X0019:Snx19 UTSW 9 30437366 missense probably damaging 1.00
X0024:Snx19 UTSW 9 30427721 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACACGCTACTGTCACCATTG -3'
(R):5'- TCATCACAGCTGTCCAACTCTAG -3'

Sequencing Primer
(F):5'- GCTACTGTCACCATTGAACAACTC -3'
(R):5'- CCGAGACTTCTCAAGAAAACTTGGG -3'
Posted On2014-08-01