Mutagenetix > Incidental Mutation

Incidental Mutation 'R1946:Snx19'

216687

Institutional Source

Beutler Lab

Gene Symbol

Snx19

Ensembl Gene

ENSMUSG00000031993

Gene Name

sorting nexin 19

Synonyms

3526401K03Rik

MMRRC Submission

039964-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R1946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30427108-30466733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30432324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 593 (N593K)

Ref Sequence

ENSEMBL: ENSMUSP00000131895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164099] [ENSMUST00000216545]

AlphaFold

Q6P4T1

Predicted Effect

probably damaging
Transcript: ENSMUST00000164099
AA Change: N593K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: N593K

Domain	Start	End	E-Value	Type
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	51	73	N/A	INTRINSIC
Pfam:PXA	96	269	2.9e-43	PFAM
low complexity region	324	335	N/A	INTRINSIC
low complexity region	371	385	N/A	INTRINSIC
low complexity region	504	528	N/A	INTRINSIC
PX	533	664	1.83e-24	SMART
Pfam:Nexin_C	843	951	1.9e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216545

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216552

Meta Mutation Damage Score

0.4527

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adamts5	C	A	16: 85,899,243	C342F	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Aen	G	C	7: 78,902,672	E32Q	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgap44	A	G	11: 65,012,096	M509T	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
Bmpr2	T	C	1: 59,868,397	V883A	possibly damaging	Het
Bpifa1	A	T	2: 154,145,634	I135F	probably damaging	Het
Bsn	A	G	9: 108,114,651	F1301L	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Ccdc18	A	G	5: 108,228,995	E1434G	probably damaging	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Cpn1	G	A	19: 43,956,518	T450M	probably benign	Het
Dlg4	A	G	11: 70,039,575	Y432C	probably damaging	Het
Dnah8	C	A	17: 30,712,385	T1458K	probably benign	Het
Dock5	A	T	14: 67,786,316	M1132K	probably damaging	Het
Dsg2	A	G	18: 20,580,548	D192G	probably damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fndc11	A	T	2: 181,221,834	D144V	probably benign	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Ganab	T	A	19: 8,910,808	D439E	probably damaging	Het
Gm10228	C	A	16: 89,041,353	G21V	unknown	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gm9573	A	T	17: 35,622,524		probably benign	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Gsdmc4	C	A	15: 63,902,780	D51Y	probably benign	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Kcnq2	T	A	2: 181,088,451	D446V	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Lrrcc1	A	G	3: 14,550,393	R394G	probably benign	Het
Lrrk2	G	A	15: 91,736,661		probably null	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Msrb3	A	G	10: 120,852,008	V54A	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Ncor2	G	A	5: 125,034,412	T1314I	probably damaging	Het
Nes	A	G	3: 87,978,514	Q1316R	possibly damaging	Het
Nfe2l3	A	C	6: 51,457,315	Q285P	probably damaging	Het
Nkd1	C	T	8: 88,592,117	H357Y	probably damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Olfr1333	T	C	4: 118,830,026	N139S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr1469	T	C	19: 13,410,779	V70A	possibly damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Otx1	G	T	11: 21,998,482	T46K	probably damaging	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Pcdhb16	T	A	18: 37,478,899	L304*	probably null	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Ppp1r12b	A	G	1: 134,892,270	V245A	probably damaging	Het
Ppp2r2d	A	G	7: 138,868,467	D19G	probably damaging	Het
Rimbp3	G	A	16: 17,210,427	V572I	probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Syngr3	T	C	17: 24,687,706	N45S	probably benign	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Usf2	T	C	7: 30,956,238	T1A	probably null	Het
Vill	A	T	9: 119,058,492	H108L	probably benign	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het
Zfp24	AC	A	18: 24,014,419		probably null	Het

Other mutations in Snx19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Snx19	APN	9	30429084	missense	possibly damaging	0.92
IGL00498:Snx19	APN	9	30428937	missense	possibly damaging	0.92
IGL00718:Snx19	APN	9	30432326	missense	probably damaging	1.00
IGL00902:Snx19	APN	9	30428732	missense	possibly damaging	0.90
IGL01433:Snx19	APN	9	30428771	missense	possibly damaging	0.93
IGL01668:Snx19	APN	9	30427823	missense	probably benign
IGL01732:Snx19	APN	9	30462353	missense	probably damaging	1.00
IGL01767:Snx19	APN	9	30463264	missense	possibly damaging	0.95
IGL02638:Snx19	APN	9	30432364	missense	possibly damaging	0.52
IGL02718:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02719:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02723:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02724:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02725:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02892:Snx19	APN	9	30428364	missense	probably damaging	1.00
IGL03061:Snx19	APN	9	30433632	missense	probably damaging	0.99
IGL03402:Snx19	APN	9	30440134	missense	possibly damaging	0.89
R0125:Snx19	UTSW	9	30440219	missense	probably damaging	1.00
R0133:Snx19	UTSW	9	30428616	missense	possibly damaging	0.94
R0196:Snx19	UTSW	9	30433387	missense	probably damaging	1.00
R0423:Snx19	UTSW	9	30435837	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428810	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428811	missense	probably damaging	1.00
R1068:Snx19	UTSW	9	30429018	missense	probably damaging	0.99
R1570:Snx19	UTSW	9	30428343	missense	probably damaging	1.00
R1727:Snx19	UTSW	9	30433366	missense	probably damaging	1.00
R1895:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1907:Snx19	UTSW	9	30433576	missense	probably damaging	0.99
R1989:Snx19	UTSW	9	30428108	missense	possibly damaging	0.93
R2029:Snx19	UTSW	9	30429000	missense	probably benign	0.01
R2914:Snx19	UTSW	9	30433532	unclassified	probably benign
R3880:Snx19	UTSW	9	30462392	missense	probably damaging	1.00
R4223:Snx19	UTSW	9	30428448	missense	possibly damaging	0.95
R4415:Snx19	UTSW	9	30437483	missense	probably damaging	0.99
R4438:Snx19	UTSW	9	30428599	missense	probably benign	0.01
R4484:Snx19	UTSW	9	30427896	missense	probably benign	0.01
R4585:Snx19	UTSW	9	30440195	missense	probably damaging	1.00
R4765:Snx19	UTSW	9	30440157	missense	probably damaging	1.00
R4771:Snx19	UTSW	9	30433638	missense	probably damaging	1.00
R4922:Snx19	UTSW	9	30437467	missense	probably benign	0.25
R5096:Snx19	UTSW	9	30428786	missense	probably benign	0.40
R5464:Snx19	UTSW	9	30427973	missense	possibly damaging	0.54
R6469:Snx19	UTSW	9	30427743	missense	possibly damaging	0.50
R6886:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R6988:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R7131:Snx19	UTSW	9	30427893	missense	probably damaging	1.00
R7268:Snx19	UTSW	9	30440177	missense	probably damaging	1.00
R7772:Snx19	UTSW	9	30428925	missense	probably damaging	0.99
R8087:Snx19	UTSW	9	30464402	missense	probably benign
R8211:Snx19	UTSW	9	30437465	missense	probably benign
R8283:Snx19	UTSW	9	30463226	missense	possibly damaging	0.56
R9000:Snx19	UTSW	9	30464323	missense	unknown
R9383:Snx19	UTSW	9	30435900	missense	probably damaging	1.00
R9436:Snx19	UTSW	9	30463306	missense	possibly damaging	0.55
R9782:Snx19	UTSW	9	30428876	missense	probably benign	0.00
X0019:Snx19	UTSW	9	30437366	missense	probably damaging	1.00
X0024:Snx19	UTSW	9	30427721	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACACGCTACTGTCACCATTG -3'
(R):5'- TCATCACAGCTGTCCAACTCTAG -3'

Sequencing Primer
(F):5'- GCTACTGTCACCATTGAACAACTC -3'
(R):5'- CCGAGACTTCTCAAGAAAACTTGGG -3'

Posted On

2014-08-01