Incidental Mutation 'R0132:Olfr417'
ID21669
Institutional Source Beutler Lab
Gene Symbol Olfr417
Ensembl Gene ENSMUSG00000066672
Gene Nameolfactory receptor 417
SynonymsGA_x6K02T2P20D-20787051-20786119, MOR267-11
MMRRC Submission 038417-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0132 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location174365122-174374472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174369586 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 223 (V223A)
Ref Sequence ENSEMBL: ENSMUSP00000151947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085862] [ENSMUST00000217962] [ENSMUST00000220394]
Predicted Effect probably damaging
Transcript: ENSMUST00000085862
AA Change: V223A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083024
Gene: ENSMUSG00000066672
AA Change: V223A

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 5.7e-46 PFAM
Pfam:7tm_1 39 303 6.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192734
Predicted Effect probably damaging
Transcript: ENSMUST00000217962
AA Change: V223A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000220394
AA Change: V223A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.2160 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Olfr417
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01885:Olfr417 APN 1 174369401 missense probably damaging 0.99
PIT4366001:Olfr417 UTSW 1 174369090 missense probably damaging 1.00
R0131:Olfr417 UTSW 1 174369586 missense probably damaging 0.99
R0131:Olfr417 UTSW 1 174369586 missense probably damaging 0.99
R1623:Olfr417 UTSW 1 174368949 missense probably benign 0.43
R1862:Olfr417 UTSW 1 174369452 missense probably damaging 0.97
R1901:Olfr417 UTSW 1 174369168 missense probably benign
R1972:Olfr417 UTSW 1 174369570 missense probably benign 0.05
R2180:Olfr417 UTSW 1 174369401 missense probably damaging 0.99
R4413:Olfr417 UTSW 1 174369474 missense probably damaging 0.98
R4528:Olfr417 UTSW 1 174369256 missense probably damaging 1.00
R4750:Olfr417 UTSW 1 174368922 missense probably benign 0.02
R4849:Olfr417 UTSW 1 174369400 missense probably damaging 0.97
R4851:Olfr417 UTSW 1 174368996 missense probably benign 0.44
R5394:Olfr417 UTSW 1 174369270 missense probably damaging 1.00
R5916:Olfr417 UTSW 1 174369132 missense probably damaging 1.00
R6248:Olfr417 UTSW 1 174369670 missense probably benign
R7311:Olfr417 UTSW 1 174369193 missense probably benign 0.30
R7868:Olfr417 UTSW 1 174368985 missense probably benign 0.00
R7951:Olfr417 UTSW 1 174368985 missense probably benign 0.00
Z1088:Olfr417 UTSW 1 174369744 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGACAACTTGTGGCCTCTGCTTG -3'
(R):5'- TGCCTGAAGAAGCTCCGGTGAAAC -3'

Sequencing Primer
(F):5'- CATTGAGACAACACTGATATTCAGGG -3'
(R):5'- CAGAGGTGATGTAACCAGTTCTCC -3'
Posted On2013-04-11