Mutagenetix > Incidental Mutation

Incidental Mutation 'R1946:Plod2'

216692

Institutional Source

Beutler Lab

Gene Symbol

Plod2

Ensembl Gene

ENSMUSG00000032374

Gene Name

procollagen lysine, 2-oxoglutarate 5-dioxygenase 2

Synonyms

D530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2

MMRRC Submission

039964-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92542223-92608428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92607135 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 707 (S707G)

Ref Sequence

ENSEMBL: ENSMUSP00000068611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]

AlphaFold

Q9R0B9

Predicted Effect

probably damaging
Transcript: ENSMUST00000070522
AA Change: S707G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: S707G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC
Blast:P4Hc	453	500	1e-22	BLAST
P4Hc	563	736	6.38e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160359
AA Change: S728G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: S728G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC
Blast:P4Hc	453	500	1e-22	BLAST
P4Hc	584	757	6.38e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190075

Meta Mutation Damage Score

0.0921

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adamts5	C	A	16: 85,899,243	C342F	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Aen	G	C	7: 78,902,672	E32Q	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgap44	A	G	11: 65,012,096	M509T	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
Bmpr2	T	C	1: 59,868,397	V883A	possibly damaging	Het
Bpifa1	A	T	2: 154,145,634	I135F	probably damaging	Het
Bsn	A	G	9: 108,114,651	F1301L	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Ccdc18	A	G	5: 108,228,995	E1434G	probably damaging	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Cpn1	G	A	19: 43,956,518	T450M	probably benign	Het
Dlg4	A	G	11: 70,039,575	Y432C	probably damaging	Het
Dnah8	C	A	17: 30,712,385	T1458K	probably benign	Het
Dock5	A	T	14: 67,786,316	M1132K	probably damaging	Het
Dsg2	A	G	18: 20,580,548	D192G	probably damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fndc11	A	T	2: 181,221,834	D144V	probably benign	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Ganab	T	A	19: 8,910,808	D439E	probably damaging	Het
Gm10228	C	A	16: 89,041,353	G21V	unknown	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gm9573	A	T	17: 35,622,524		probably benign	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Gsdmc4	C	A	15: 63,902,780	D51Y	probably benign	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Kcnq2	T	A	2: 181,088,451	D446V	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Lrrcc1	A	G	3: 14,550,393	R394G	probably benign	Het
Lrrk2	G	A	15: 91,736,661		probably null	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Msrb3	A	G	10: 120,852,008	V54A	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Ncor2	G	A	5: 125,034,412	T1314I	probably damaging	Het
Nes	A	G	3: 87,978,514	Q1316R	possibly damaging	Het
Nfe2l3	A	C	6: 51,457,315	Q285P	probably damaging	Het
Nkd1	C	T	8: 88,592,117	H357Y	probably damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Olfr1333	T	C	4: 118,830,026	N139S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr1469	T	C	19: 13,410,779	V70A	possibly damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Otx1	G	T	11: 21,998,482	T46K	probably damaging	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Pcdhb16	T	A	18: 37,478,899	L304*	probably null	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Ppp1r12b	A	G	1: 134,892,270	V245A	probably damaging	Het
Ppp2r2d	A	G	7: 138,868,467	D19G	probably damaging	Het
Rimbp3	G	A	16: 17,210,427	V572I	probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Syngr3	T	C	17: 24,687,706	N45S	probably benign	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Usf2	T	C	7: 30,956,238	T1A	probably null	Het
Vill	A	T	9: 119,058,492	H108L	probably benign	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het
Zfp24	AC	A	18: 24,014,419		probably null	Het

Other mutations in Plod2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Plod2	APN	9	92598614	missense	probably damaging	0.99
IGL00945:Plod2	APN	9	92584496	missense	probably benign	0.08
IGL01386:Plod2	APN	9	92606602	missense	probably damaging	0.99
IGL01519:Plod2	APN	9	92595295	missense	probably benign	0.00
IGL01836:Plod2	APN	9	92606498	splice site	probably benign
IGL02490:Plod2	APN	9	92586842	missense	probably benign	0.00
IGL02496:Plod2	APN	9	92607094	missense	probably damaging	1.00
IGL02699:Plod2	APN	9	92607142	missense	probably damaging	1.00
IGL02735:Plod2	APN	9	92595389	splice site	probably benign
IGL03106:Plod2	APN	9	92573567	missense	probably damaging	0.98
R0270:Plod2	UTSW	9	92584521	missense	probably benign	0.10
R0546:Plod2	UTSW	9	92595335	missense	probably damaging	1.00
R0589:Plod2	UTSW	9	92593746	missense	probably benign
R0707:Plod2	UTSW	9	92605427	missense	possibly damaging	0.91
R1491:Plod2	UTSW	9	92606584	missense	probably benign	0.00
R1572:Plod2	UTSW	9	92603067	splice site	probably benign
R1731:Plod2	UTSW	9	92584604	critical splice donor site	probably null
R1895:Plod2	UTSW	9	92607135	missense	probably damaging	1.00
R1917:Plod2	UTSW	9	92581257	missense	probably benign
R3850:Plod2	UTSW	9	92542545	missense	probably benign	0.28
R3973:Plod2	UTSW	9	92598619	nonsense	probably null
R3974:Plod2	UTSW	9	92598619	nonsense	probably null
R4289:Plod2	UTSW	9	92602988	missense	possibly damaging	0.89
R4423:Plod2	UTSW	9	92601989	missense	probably benign	0.00
R4647:Plod2	UTSW	9	92605450	nonsense	probably null
R4754:Plod2	UTSW	9	92606531	nonsense	probably null
R4769:Plod2	UTSW	9	92595272	missense	probably damaging	1.00
R5279:Plod2	UTSW	9	92581323	missense	probably damaging	1.00
R5535:Plod2	UTSW	9	92606569	missense	probably damaging	1.00
R5654:Plod2	UTSW	9	92593823	missense	probably benign
R5764:Plod2	UTSW	9	92603021	missense	probably damaging	0.97
R5885:Plod2	UTSW	9	92606656	critical splice donor site	probably null
R5940:Plod2	UTSW	9	92591397	missense	probably benign	0.39
R6917:Plod2	UTSW	9	92593770	missense	possibly damaging	0.87
R7109:Plod2	UTSW	9	92573597	missense	probably damaging	1.00
R7221:Plod2	UTSW	9	92584527	missense	probably damaging	1.00
R7311:Plod2	UTSW	9	92584558	missense	probably damaging	1.00
R7963:Plod2	UTSW	9	92605446	missense	probably benign	0.07
R8205:Plod2	UTSW	9	92542318	start gained	probably benign
R8794:Plod2	UTSW	9	92600748	missense	probably damaging	0.98
R8873:Plod2	UTSW	9	92607059	intron	probably benign
R9044:Plod2	UTSW	9	92607220	missense	probably damaging	0.97
R9071:Plod2	UTSW	9	92602995	missense	probably benign	0.09
R9120:Plod2	UTSW	9	92542327	start gained	probably benign
Z1088:Plod2	UTSW	9	92603035	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGGAAAAGGCTCTGCTGATATTTG -3'
(R):5'- GCCCAAAGTGATGTTGTTCTG -3'

Sequencing Primer
(F):5'- GCCATTTAGATGGCACAGT -3'
(R):5'- CCCAAAGTGATGTTGTTCTGTTGAC -3'

Posted On

2014-08-01