Mutagenetix > Incidental Mutation

Incidental Mutation 'R1946:Bsn'

216693

Institutional Source

Beutler Lab

Gene Symbol

Bsn

Ensembl Gene

ENSMUSG00000032589

Gene Name

bassoon

Synonyms

presynaptic cytomatrix protein

MMRRC Submission

039964-MU

Accession Numbers

Genbank: NM_007567; MGI: 1277955

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R1946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108096022-108190384 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108114651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1301 (F1301L)

Ref Sequence

ENSEMBL: ENSMUSP00000035208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035208]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035208
AA Change: F1301L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: F1301L

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	77	N/A	INTRINSIC
Pfam:zf-piccolo	165	223	6.1e-30	PFAM
low complexity region	394	409	N/A	INTRINSIC
low complexity region	445	454	N/A	INTRINSIC
Pfam:zf-piccolo	462	520	5.2e-31	PFAM
low complexity region	527	540	N/A	INTRINSIC
low complexity region	627	643	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
low complexity region	788	803	N/A	INTRINSIC
low complexity region	994	1021	N/A	INTRINSIC
coiled coil region	1047	1101	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1173	1190	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1443	1455	N/A	INTRINSIC
low complexity region	1481	1498	N/A	INTRINSIC
low complexity region	1790	1800	N/A	INTRINSIC
low complexity region	2117	2126	N/A	INTRINSIC
low complexity region	2287	2303	N/A	INTRINSIC
low complexity region	2326	2356	N/A	INTRINSIC
SCOP:d1eq1a_	2362	2477	2e-7	SMART
low complexity region	2607	2614	N/A	INTRINSIC
low complexity region	2635	2651	N/A	INTRINSIC
low complexity region	2655	2672	N/A	INTRINSIC
coiled coil region	2949	2990	N/A	INTRINSIC
low complexity region	3057	3071	N/A	INTRINSIC
low complexity region	3089	3114	N/A	INTRINSIC
low complexity region	3446	3461	N/A	INTRINSIC
low complexity region	3520	3534	N/A	INTRINSIC
low complexity region	3653	3666	N/A	INTRINSIC
low complexity region	3750	3820	N/A	INTRINSIC
low complexity region	3831	3852	N/A	INTRINSIC
low complexity region	3856	3901	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124763

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adamts5	C	A	16: 85,899,243	C342F	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Aen	G	C	7: 78,902,672	E32Q	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgap44	A	G	11: 65,012,096	M509T	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
Bmpr2	T	C	1: 59,868,397	V883A	possibly damaging	Het
Bpifa1	A	T	2: 154,145,634	I135F	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Ccdc18	A	G	5: 108,228,995	E1434G	probably damaging	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Cpn1	G	A	19: 43,956,518	T450M	probably benign	Het
Dlg4	A	G	11: 70,039,575	Y432C	probably damaging	Het
Dnah8	C	A	17: 30,712,385	T1458K	probably benign	Het
Dock5	A	T	14: 67,786,316	M1132K	probably damaging	Het
Dsg2	A	G	18: 20,580,548	D192G	probably damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fndc11	A	T	2: 181,221,834	D144V	probably benign	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Ganab	T	A	19: 8,910,808	D439E	probably damaging	Het
Gm10228	C	A	16: 89,041,353	G21V	unknown	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gm9573	A	T	17: 35,622,524		probably benign	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Gsdmc4	C	A	15: 63,902,780	D51Y	probably benign	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Kcnq2	T	A	2: 181,088,451	D446V	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Lrrcc1	A	G	3: 14,550,393	R394G	probably benign	Het
Lrrk2	G	A	15: 91,736,661		probably null	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Msrb3	A	G	10: 120,852,008	V54A	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Ncor2	G	A	5: 125,034,412	T1314I	probably damaging	Het
Nes	A	G	3: 87,978,514	Q1316R	possibly damaging	Het
Nfe2l3	A	C	6: 51,457,315	Q285P	probably damaging	Het
Nkd1	C	T	8: 88,592,117	H357Y	probably damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Olfr1333	T	C	4: 118,830,026	N139S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr1469	T	C	19: 13,410,779	V70A	possibly damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Otx1	G	T	11: 21,998,482	T46K	probably damaging	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Pcdhb16	T	A	18: 37,478,899	L304*	probably null	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Ppp1r12b	A	G	1: 134,892,270	V245A	probably damaging	Het
Ppp2r2d	A	G	7: 138,868,467	D19G	probably damaging	Het
Rimbp3	G	A	16: 17,210,427	V572I	probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Syngr3	T	C	17: 24,687,706	N45S	probably benign	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Usf2	T	C	7: 30,956,238	T1A	probably null	Het
Vill	A	T	9: 119,058,492	H108L	probably benign	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het
Zfp24	AC	A	18: 24,014,419		probably null	Het

Other mutations in Bsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Bsn	APN	9	108115110	missense	probably benign	0.01
IGL00330:Bsn	APN	9	108115340	missense	probably damaging	1.00
IGL00863:Bsn	APN	9	108115322	missense	probably damaging	1.00
IGL01123:Bsn	APN	9	108115986	missense	probably damaging	1.00
IGL01330:Bsn	APN	9	108110913	unclassified	probably benign
IGL01336:Bsn	APN	9	108111785	missense	probably damaging	0.99
IGL01399:Bsn	APN	9	108107187	missense	unknown
IGL01683:Bsn	APN	9	108114896	missense	possibly damaging	0.71
IGL02022:Bsn	APN	9	108110418	unclassified	probably benign
IGL02396:Bsn	APN	9	108116046	missense	possibly damaging	0.90
IGL02538:Bsn	APN	9	108105236	missense	unknown
IGL02565:Bsn	APN	9	108113288	missense	probably damaging	0.99
IGL02661:Bsn	APN	9	108106936	nonsense	probably null
IGL02739:Bsn	APN	9	108112546	missense	probably benign	0.14
IGL02951:Bsn	APN	9	108115613	missense	probably damaging	1.00
IGL02987:Bsn	APN	9	108126304	missense	probably benign	0.03
IGL03033:Bsn	APN	9	108115993	missense	probably damaging	1.00
IGL03069:Bsn	APN	9	108114263	missense	probably damaging	1.00
IGL03076:Bsn	APN	9	108105382	missense	unknown
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0068:Bsn	UTSW	9	108112137	missense	probably damaging	1.00
R0167:Bsn	UTSW	9	108125986	missense	probably benign	0.01
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0234:Bsn	UTSW	9	108116396	missense	possibly damaging	0.50
R0359:Bsn	UTSW	9	108111846	missense	possibly damaging	0.81
R0514:Bsn	UTSW	9	108125782	missense	probably benign	0.07
R0593:Bsn	UTSW	9	108110306	missense	unknown
R0617:Bsn	UTSW	9	108107240	missense	unknown
R0636:Bsn	UTSW	9	108107834	missense	unknown
R0652:Bsn	UTSW	9	108105742	missense	unknown
R0718:Bsn	UTSW	9	108111360	unclassified	probably benign
R0730:Bsn	UTSW	9	108106812	missense	unknown
R0905:Bsn	UTSW	9	108105635	missense	unknown
R0963:Bsn	UTSW	9	108111807	missense	possibly damaging	0.81
R0992:Bsn	UTSW	9	108114354	nonsense	probably null
R1101:Bsn	UTSW	9	108116411	missense	probably damaging	1.00
R1393:Bsn	UTSW	9	108110517	unclassified	probably benign
R1490:Bsn	UTSW	9	108113994	missense	probably benign	0.03
R1566:Bsn	UTSW	9	108125985	missense	probably benign	0.35
R1582:Bsn	UTSW	9	108105092	missense	unknown
R1738:Bsn	UTSW	9	108106934	missense	unknown
R1867:Bsn	UTSW	9	108106719	missense	unknown
R1918:Bsn	UTSW	9	108107573	missense	unknown
R1933:Bsn	UTSW	9	108116444	missense	possibly damaging	0.91
R1978:Bsn	UTSW	9	108114549	missense	probably benign	0.35
R2068:Bsn	UTSW	9	108110684	unclassified	probably benign
R2068:Bsn	UTSW	9	108126550	missense	possibly damaging	0.95
R2113:Bsn	UTSW	9	108114886	missense	probably benign	0.14
R2136:Bsn	UTSW	9	108113231	missense	probably damaging	1.00
R2172:Bsn	UTSW	9	108109992	intron	probably benign
R2266:Bsn	UTSW	9	108115124	missense	probably damaging	1.00
R2293:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2294:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2368:Bsn	UTSW	9	108111030	nonsense	probably null
R2442:Bsn	UTSW	9	108106920	missense	unknown
R2507:Bsn	UTSW	9	108116114	missense	probably damaging	1.00
R2880:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2881:Bsn	UTSW	9	108113067	missense	possibly damaging	0.47
R2922:Bsn	UTSW	9	108108186	missense	unknown
R2922:Bsn	UTSW	9	108115469	missense	probably damaging	1.00
R3618:Bsn	UTSW	9	108117561	critical splice acceptor site	probably null
R3742:Bsn	UTSW	9	108105739	missense	unknown
R3825:Bsn	UTSW	9	108106856	missense	unknown
R3982:Bsn	UTSW	9	108107166	missense	unknown
R4094:Bsn	UTSW	9	108113870	missense	probably damaging	1.00
R4158:Bsn	UTSW	9	108112946	missense	possibly damaging	0.95
R4225:Bsn	UTSW	9	108106733	missense	unknown
R4261:Bsn	UTSW	9	108110684	unclassified	probably benign
R4482:Bsn	UTSW	9	108114664	missense	probably damaging	1.00
R4515:Bsn	UTSW	9	108104078	splice site	probably null
R4585:Bsn	UTSW	9	108110463	unclassified	probably benign
R4628:Bsn	UTSW	9	108113235	missense	probably damaging	1.00
R4636:Bsn	UTSW	9	108115424	missense	probably damaging	1.00
R4679:Bsn	UTSW	9	108110130	missense	unknown
R4723:Bsn	UTSW	9	108112655	missense	probably benign	0.03
R4843:Bsn	UTSW	9	108107189	missense	unknown
R4885:Bsn	UTSW	9	108107527	nonsense	probably null
R4936:Bsn	UTSW	9	108111761	missense	probably damaging	1.00
R4942:Bsn	UTSW	9	108106479	missense	unknown
R4972:Bsn	UTSW	9	108115178	missense	probably damaging	1.00
R4992:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R5067:Bsn	UTSW	9	108111953	missense	probably damaging	1.00
R5206:Bsn	UTSW	9	108105373	missense	unknown
R5286:Bsn	UTSW	9	108110924	unclassified	probably benign
R5492:Bsn	UTSW	9	108112515	missense	probably damaging	0.98
R5553:Bsn	UTSW	9	108110421	unclassified	probably benign
R5561:Bsn	UTSW	9	108105511	missense	unknown
R5597:Bsn	UTSW	9	108114932	missense	probably benign	0.06
R5646:Bsn	UTSW	9	108110432	unclassified	probably benign
R5796:Bsn	UTSW	9	108126024	missense	probably damaging	1.00
R5801:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5802:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R5850:Bsn	UTSW	9	108114950	missense	probably damaging	0.99
R5938:Bsn	UTSW	9	108113009	missense	possibly damaging	0.81
R6221:Bsn	UTSW	9	108105566	missense	unknown
R6243:Bsn	UTSW	9	108107561	missense	unknown
R6254:Bsn	UTSW	9	108111866	missense	probably damaging	0.96
R6263:Bsn	UTSW	9	108113254	missense	probably damaging	1.00
R6345:Bsn	UTSW	9	108107355	missense	unknown
R6368:Bsn	UTSW	9	108111314	unclassified	probably benign
R6574:Bsn	UTSW	9	108113954	missense	possibly damaging	0.95
R6793:Bsn	UTSW	9	108114615	nonsense	probably null
R6802:Bsn	UTSW	9	108110624	unclassified	probably benign
R6943:Bsn	UTSW	9	108107817	missense	unknown
R6999:Bsn	UTSW	9	108113433	missense	probably benign	0.00
R7149:Bsn	UTSW	9	108116321	nonsense	probably null
R7199:Bsn	UTSW	9	108115334	missense	probably damaging	1.00
R7322:Bsn	UTSW	9	108126421	nonsense	probably null
R7349:Bsn	UTSW	9	108110783	missense	unknown
R7372:Bsn	UTSW	9	108110519	missense	unknown
R7373:Bsn	UTSW	9	108113484	missense	probably damaging	1.00
R7413:Bsn	UTSW	9	108139491	missense	possibly damaging	0.61
R7473:Bsn	UTSW	9	108112250	missense	probably damaging	1.00
R7482:Bsn	UTSW	9	108113529	missense	probably damaging	0.98
R7530:Bsn	UTSW	9	108111956	missense	probably damaging	1.00
R7549:Bsn	UTSW	9	108114815	missense	probably benign	0.05
R7570:Bsn	UTSW	9	108113543	missense	probably damaging	1.00
R7635:Bsn	UTSW	9	108110990	missense	unknown
R7696:Bsn	UTSW	9	108114501	missense	probably damaging	1.00
R7757:Bsn	UTSW	9	108114740	missense	possibly damaging	0.90
R7868:Bsn	UTSW	9	108114899	missense	possibly damaging	0.95
R7897:Bsn	UTSW	9	108111866	missense	probably damaging	0.98
R7960:Bsn	UTSW	9	108115548	missense	probably damaging	1.00
R8022:Bsn	UTSW	9	108114404	missense	probably benign	0.01
R8056:Bsn	UTSW	9	108105307	missense
R8158:Bsn	UTSW	9	108110033	missense	unknown
R8161:Bsn	UTSW	9	108139530	missense	probably benign	0.20
R8225:Bsn	UTSW	9	108107106	missense
R8282:Bsn	UTSW	9	108107691	missense	possibly damaging	0.73
R8296:Bsn	UTSW	9	108117379	missense	probably benign	0.00
R8415:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8417:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8426:Bsn	UTSW	9	108126573	missense	probably damaging	1.00
R8437:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8438:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8439:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8440:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8441:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8442:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8513:Bsn	UTSW	9	108114510	missense	possibly damaging	0.65
R8529:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8535:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8546:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8548:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8549:Bsn	UTSW	9	108111452	missense	probably benign	0.00
R8682:Bsn	UTSW	9	108106169	missense
R8773:Bsn	UTSW	9	108110505	missense	unknown
R8883:Bsn	UTSW	9	108113028	missense	probably damaging	0.98
R8906:Bsn	UTSW	9	108107553	missense	unknown
R9018:Bsn	UTSW	9	108117289	missense	probably benign	0.06
R9070:Bsn	UTSW	9	108110096	missense
R9094:Bsn	UTSW	9	108110853	missense	unknown
R9098:Bsn	UTSW	9	108112974	missense	possibly damaging	0.65
R9128:Bsn	UTSW	9	108116150	missense	probably benign	0.21
R9162:Bsn	UTSW	9	108110684	missense	unknown
R9224:Bsn	UTSW	9	108105487	missense
R9230:Bsn	UTSW	9	108112260	missense	probably damaging	1.00
R9233:Bsn	UTSW	9	108117090	missense	probably benign	0.28
R9245:Bsn	UTSW	9	108116093	missense	probably damaging	1.00
R9275:Bsn	UTSW	9	108111620	missense	probably damaging	1.00
R9307:Bsn	UTSW	9	108115794	missense	probably benign	0.01
R9343:Bsn	UTSW	9	108115502	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108113601	missense	probably damaging	1.00
R9377:Bsn	UTSW	9	108116162	missense	probably damaging	1.00
R9378:Bsn	UTSW	9	108107655	missense	possibly damaging	0.85
R9408:Bsn	UTSW	9	108139453	nonsense	probably null
R9455:Bsn	UTSW	9	108111332	missense	unknown
R9563:Bsn	UTSW	9	108107417	missense
R9615:Bsn	UTSW	9	108107231	missense
R9656:Bsn	UTSW	9	108117208	missense	probably benign	0.09
R9698:Bsn	UTSW	9	108115971	missense	probably damaging	1.00
X0028:Bsn	UTSW	9	108113504	missense	probably damaging	1.00
X0066:Bsn	UTSW	9	108139210	missense	probably damaging	1.00
Z1177:Bsn	UTSW	9	108105499	missense
Z1177:Bsn	UTSW	9	108139195	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTGAGAGGATCCTGAGG -3'
(R):5'- AGGGCTCCTTTGAATATCAAGAC -3'

Sequencing Primer
(F):5'- CTGAGGCTCTTTTGCAAAATGC -3'
(R):5'- TCCTTTGAATATCAAGACACCCAAG -3'

Posted On

2014-08-01