Incidental Mutation 'R0132:Psd4'
ID21670
Institutional Source Beutler Lab
Gene Symbol Psd4
Ensembl Gene ENSMUSG00000026979
Gene Namepleckstrin and Sec7 domain containing 4
SynonymsSEC7 homolog, EFA6B
MMRRC Submission 038417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0132 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location24367580-24414954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24405351 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 839 (A839E)
Ref Sequence ENSEMBL: ENSMUSP00000132395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056641] [ENSMUST00000102942] [ENSMUST00000140303] [ENSMUST00000166388]
Predicted Effect probably damaging
Transcript: ENSMUST00000056641
AA Change: A839E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062415
Gene: ENSMUSG00000026979
AA Change: A839E

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102942
AA Change: A839E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100006
Gene: ENSMUSG00000026979
AA Change: A839E

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132924
Predicted Effect probably benign
Transcript: ENSMUST00000140303
Predicted Effect probably damaging
Transcript: ENSMUST00000166388
AA Change: A839E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132395
Gene: ENSMUSG00000026979
AA Change: A839E

DomainStartEndE-ValueType
low complexity region 156 176 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 420 438 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Sec7 497 688 9.39e-47 SMART
PH 727 843 1.1e-10 SMART
low complexity region 883 893 N/A INTRINSIC
low complexity region 897 920 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Psd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Psd4 APN 2 24394286 missense probably benign 0.25
IGL01302:Psd4 APN 2 24396787 critical splice donor site probably null
IGL01446:Psd4 APN 2 24405395 missense probably damaging 1.00
IGL01577:Psd4 APN 2 24403222 missense probably damaging 0.96
IGL01823:Psd4 APN 2 24394432 missense probably benign 0.27
IGL02103:Psd4 APN 2 24400528 nonsense probably null
IGL02212:Psd4 APN 2 24405314 nonsense probably null
IGL02240:Psd4 APN 2 24396377 missense probably benign 0.00
IGL02261:Psd4 APN 2 24401744 missense probably damaging 1.00
IGL02345:Psd4 APN 2 24401823 critical splice donor site probably null
IGL03272:Psd4 APN 2 24405680 splice site probably benign
bitcoin UTSW 2 24401557 missense probably damaging 1.00
crypto UTSW 2 24397247 missense probably benign
underworld UTSW 2 24405351 missense probably damaging 1.00
PIT4469001:Psd4 UTSW 2 24394294 missense probably benign 0.08
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0131:Psd4 UTSW 2 24405351 missense probably damaging 1.00
R0278:Psd4 UTSW 2 24394438 missense probably damaging 1.00
R1303:Psd4 UTSW 2 24395018 missense probably benign 0.00
R1551:Psd4 UTSW 2 24403280 missense probably benign 0.02
R1715:Psd4 UTSW 2 24405332 missense probably damaging 1.00
R1854:Psd4 UTSW 2 24397456 missense probably benign 0.26
R1942:Psd4 UTSW 2 24405793 missense probably damaging 1.00
R2392:Psd4 UTSW 2 24394667 missense probably damaging 0.98
R2420:Psd4 UTSW 2 24401241 missense probably damaging 1.00
R4509:Psd4 UTSW 2 24396335 missense probably benign
R4512:Psd4 UTSW 2 24402889 missense probably damaging 1.00
R4558:Psd4 UTSW 2 24404794 missense probably damaging 1.00
R4995:Psd4 UTSW 2 24397247 missense probably benign
R5120:Psd4 UTSW 2 24405438 missense probably benign
R5314:Psd4 UTSW 2 24400516 missense possibly damaging 0.89
R5563:Psd4 UTSW 2 24394885 missense probably benign
R5638:Psd4 UTSW 2 24397415 missense probably benign 0.14
R6191:Psd4 UTSW 2 24394487 missense probably damaging 1.00
R6224:Psd4 UTSW 2 24401557 missense probably damaging 1.00
R7024:Psd4 UTSW 2 24394543 missense possibly damaging 0.76
R7046:Psd4 UTSW 2 24394973 missense probably benign 0.05
R7209:Psd4 UTSW 2 24397345 missense probably damaging 1.00
R7483:Psd4 UTSW 2 24404756 missense possibly damaging 0.65
R7498:Psd4 UTSW 2 24406984 missense probably damaging 1.00
R7571:Psd4 UTSW 2 24407011 missense probably damaging 1.00
R7741:Psd4 UTSW 2 24401096 critical splice donor site probably null
X0009:Psd4 UTSW 2 24401525 missense probably damaging 1.00
X0064:Psd4 UTSW 2 24404738 missense probably damaging 0.99
Z1177:Psd4 UTSW 2 24394912 missense possibly damaging 0.95
Z1177:Psd4 UTSW 2 24394931 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAATGCCACCAACGACTGACTTTTG -3'
(R):5'- AGGATGCCTGAATCTACCTCTGCC -3'

Sequencing Primer
(F):5'- CCTCTGTCAGATAAAATTCAGTGCC -3'
(R):5'- GAATCTACCTCTGCCCTCCC -3'
Posted On2013-04-11