Incidental Mutation 'R1946:Dlg4'
ID 216703
Institutional Source Beutler Lab
Gene Symbol Dlg4
Ensembl Gene ENSMUSG00000020886
Gene Name discs large MAGUK scaffold protein 4
Synonyms PSD95, Dlgh4, SAP90, PSD-95, SAP90A
MMRRC Submission 039964-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1946 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70016942-70047522 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70039575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 432 (Y432C)
Ref Sequence ENSEMBL: ENSMUSP00000155973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018700] [ENSMUST00000108588] [ENSMUST00000108589] [ENSMUST00000123687] [ENSMUST00000132597] [ENSMUST00000231221] [ENSMUST00000231415] [ENSMUST00000231452] [ENSMUST00000231506] [ENSMUST00000231628]
AlphaFold Q62108
Predicted Effect probably damaging
Transcript: ENSMUST00000018700
AA Change: Y332C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018700
Gene: ENSMUSG00000020886
AA Change: Y332C

DomainStartEndE-ValueType
MAGUK_N_PEST 10 64 1.36e-4 SMART
PDZ 73 152 3.38e-21 SMART
PDZ 168 247 1.12e-21 SMART
PDZ 321 394 4.13e-25 SMART
SH3 431 497 1.68e-9 SMART
GuKc 533 712 3.65e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108588
AA Change: Y392C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104229
Gene: ENSMUSG00000020886
AA Change: Y392C

DomainStartEndE-ValueType
MAGUK_N_PEST 10 61 1e-7 SMART
PDZ 70 149 3.38e-21 SMART
PDZ 165 244 1.12e-21 SMART
PDZ 318 391 4.13e-25 SMART
SH3 428 494 1.68e-9 SMART
GuKc 530 709 3.65e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108589
AA Change: Y435C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104230
Gene: ENSMUSG00000020886
AA Change: Y435C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
MAGUK_N_PEST 53 107 1.36e-4 SMART
PDZ 116 195 3.38e-21 SMART
PDZ 211 290 1.12e-21 SMART
PDZ 364 437 4.13e-25 SMART
SH3 474 540 1.68e-9 SMART
GuKc 576 755 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123687
AA Change: Y435C

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134545
Gene: ENSMUSG00000020886
AA Change: Y435C

DomainStartEndE-ValueType
SH3 11 77 1.68e-9 SMART
GuKc 113 205 7.37e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131497
Predicted Effect probably benign
Transcript: ENSMUST00000132597
SMART Domains Protein: ENSMUSP00000114165
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
Pfam:MAGUK_N_PEST 2 43 5.8e-13 PFAM
PDZ 52 131 3.38e-21 SMART
PDZ 147 226 1.12e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231221
Predicted Effect probably damaging
Transcript: ENSMUST00000231415
AA Change: Y389C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000231452
AA Change: Y332C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231506
AA Change: Y432C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231628
AA Change: Y332C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. It heteromultimerizes with another MAGUK protein, DLG2, and is recruited into NMDA receptor and potassium channel clusters. These two MAGUK proteins may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severely impaired spatial learning, alterations in long-term potentiation and depression, and lack of hyperalgesia responses in a neuropathic pain model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adamts5 C A 16: 85,899,243 C342F probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Aen G C 7: 78,902,672 E32Q probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgap44 A G 11: 65,012,096 M509T probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
Bmpr2 T C 1: 59,868,397 V883A possibly damaging Het
Bpifa1 A T 2: 154,145,634 I135F probably damaging Het
Bsn A G 9: 108,114,651 F1301L probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Ccdc18 A G 5: 108,228,995 E1434G probably damaging Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Cpn1 G A 19: 43,956,518 T450M probably benign Het
Dnah8 C A 17: 30,712,385 T1458K probably benign Het
Dock5 A T 14: 67,786,316 M1132K probably damaging Het
Dsg2 A G 18: 20,580,548 D192G probably damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fndc11 A T 2: 181,221,834 D144V probably benign Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Ganab T A 19: 8,910,808 D439E probably damaging Het
Gm10228 C A 16: 89,041,353 G21V unknown Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gm9573 A T 17: 35,622,524 probably benign Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Gsdmc4 C A 15: 63,902,780 D51Y probably benign Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Kcnq2 T A 2: 181,088,451 D446V probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Lrrcc1 A G 3: 14,550,393 R394G probably benign Het
Lrrk2 G A 15: 91,736,661 probably null Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Msrb3 A G 10: 120,852,008 V54A probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Ncor2 G A 5: 125,034,412 T1314I probably damaging Het
Nes A G 3: 87,978,514 Q1316R possibly damaging Het
Nfe2l3 A C 6: 51,457,315 Q285P probably damaging Het
Nkd1 C T 8: 88,592,117 H357Y probably damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Olfr1333 T C 4: 118,830,026 N139S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr1469 T C 19: 13,410,779 V70A possibly damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Otx1 G T 11: 21,998,482 T46K probably damaging Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Pcdhb16 T A 18: 37,478,899 L304* probably null Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Ppp1r12b A G 1: 134,892,270 V245A probably damaging Het
Ppp2r2d A G 7: 138,868,467 D19G probably damaging Het
Rimbp3 G A 16: 17,210,427 V572I probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Syngr3 T C 17: 24,687,706 N45S probably benign Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Usf2 T C 7: 30,956,238 T1A probably null Het
Vill A T 9: 119,058,492 H108L probably benign Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Zfp24 AC A 18: 24,014,419 probably null Het
Other mutations in Dlg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Dlg4 APN 11 70041347 missense probably damaging 1.00
IGL02260:Dlg4 APN 11 70042267 missense probably damaging 1.00
IGL03097:Dlg4 UTSW 11 70042202 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0628:Dlg4 UTSW 11 70031784 missense probably damaging 1.00
R0734:Dlg4 UTSW 11 70042705 missense probably damaging 1.00
R1587:Dlg4 UTSW 11 70031746 missense possibly damaging 0.88
R2190:Dlg4 UTSW 11 70042604 missense probably damaging 1.00
R2259:Dlg4 UTSW 11 70031370 missense probably damaging 1.00
R2289:Dlg4 UTSW 11 70026926 missense probably damaging 1.00
R2411:Dlg4 UTSW 11 70041929 critical splice donor site probably null
R3161:Dlg4 UTSW 11 70017225 missense probably damaging 0.99
R4059:Dlg4 UTSW 11 70027083 missense probably benign
R4782:Dlg4 UTSW 11 70026954 missense probably damaging 1.00
R4910:Dlg4 UTSW 11 70030925 missense probably damaging 1.00
R5077:Dlg4 UTSW 11 70027026 missense possibly damaging 0.71
R5557:Dlg4 UTSW 11 70042280 missense probably damaging 1.00
R5996:Dlg4 UTSW 11 70017231 missense probably benign 0.00
R6649:Dlg4 UTSW 11 70023953 unclassified probably benign
R6653:Dlg4 UTSW 11 70023953 unclassified probably benign
R7155:Dlg4 UTSW 11 70017216 start codon destroyed probably null 0.00
R7284:Dlg4 UTSW 11 70042082 nonsense probably null
R7683:Dlg4 UTSW 11 70039854 missense possibly damaging 0.95
R7976:Dlg4 UTSW 11 70039182 missense probably damaging 0.99
R8051:Dlg4 UTSW 11 70031642 unclassified probably benign
R8408:Dlg4 UTSW 11 70042252 missense possibly damaging 0.81
R8431:Dlg4 UTSW 11 70039562 missense probably benign 0.36
R9283:Dlg4 UTSW 11 70031791 nonsense probably null
R9451:Dlg4 UTSW 11 70031239 missense probably damaging 1.00
Z1088:Dlg4 UTSW 11 70031130 missense probably damaging 1.00
Z1176:Dlg4 UTSW 11 70041920 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGAGAGTCCTGTGCTCTTGG -3'
(R):5'- TCGGCTATACTCTGAGAAAGGAC -3'

Sequencing Primer
(F):5'- GGCTCAATGGGCTCAAGC -3'
(R):5'- CAAGAAGGTTCTGGAACTCTGCC -3'
Posted On 2014-08-01