Incidental Mutation 'R1946:Adamts5'
ID216714
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms9530092O11Rik, ADAM-TS5
MMRRC Submission 039964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R1946 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location85856173-85901828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85899243 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 342 (C342F)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
Predicted Effect probably damaging
Transcript: ENSMUST00000023611
AA Change: C342F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: C342F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Aen G C 7: 78,902,672 E32Q probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgap44 A G 11: 65,012,096 M509T probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
Bmpr2 T C 1: 59,868,397 V883A possibly damaging Het
Bpifa1 A T 2: 154,145,634 I135F probably damaging Het
Bsn A G 9: 108,114,651 F1301L probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Ccdc18 A G 5: 108,228,995 E1434G probably damaging Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Cpn1 G A 19: 43,956,518 T450M probably benign Het
Dlg4 A G 11: 70,039,575 Y432C probably damaging Het
Dnah8 C A 17: 30,712,385 T1458K probably benign Het
Dock5 A T 14: 67,786,316 M1132K probably damaging Het
Dsg2 A G 18: 20,580,548 D192G probably damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fndc11 A T 2: 181,221,834 D144V probably benign Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Ganab T A 19: 8,910,808 D439E probably damaging Het
Gm10228 C A 16: 89,041,353 G21V unknown Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gm9573 A T 17: 35,622,524 probably benign Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Gsdmc4 C A 15: 63,902,780 D51Y probably benign Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Kcnq2 T A 2: 181,088,451 D446V probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Lrrcc1 A G 3: 14,550,393 R394G probably benign Het
Lrrk2 G A 15: 91,736,661 probably null Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Msrb3 A G 10: 120,852,008 V54A probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Ncor2 G A 5: 125,034,412 T1314I probably damaging Het
Nes A G 3: 87,978,514 Q1316R possibly damaging Het
Nfe2l3 A C 6: 51,457,315 Q285P probably damaging Het
Nkd1 C T 8: 88,592,117 H357Y probably damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Olfr1333 T C 4: 118,830,026 N139S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr1469 T C 19: 13,410,779 V70A possibly damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Otx1 G T 11: 21,998,482 T46K probably damaging Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Pcdhb16 T A 18: 37,478,899 L304* probably null Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Ppp1r12b A G 1: 134,892,270 V245A probably damaging Het
Ppp2r2d A G 7: 138,868,467 D19G probably damaging Het
Rimbp3 G A 16: 17,210,427 V572I probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Sulf1 T C 1: 12,796,907 V105A probably benign Het
Syngr3 T C 17: 24,687,706 N45S probably benign Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Usf2 T C 7: 30,956,238 T1A probably null Het
Vill A T 9: 119,058,492 H108L probably benign Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Zfp24 AC A 18: 24,014,419 probably null Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably null
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTTTGCATGCAAGATG -3'
(R):5'- GTCCATGGCCAGGATGTATG -3'

Sequencing Primer
(F):5'- CTATTGAGTGACAAGTCCTTTATGG -3'
(R):5'- GCCAGGATGTATGGGCGG -3'
Posted On2014-08-01