Incidental Mutation 'R0132:Bpifa6'
Institutional Source Beutler Lab
Gene Symbol Bpifa6
Ensembl Gene ENSMUSG00000078998
Gene NameBPI fold containing family A, member 6
MMRRC Submission 038417-MU
Accession Numbers

Genbank: NM_001080811MGI: 3647736  

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0132 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location153974945-154000495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153982931 bp
Amino Acid Change Serine to Threonine at position 9 (S9T)
Ref Sequence ENSEMBL: ENSMUSP00000105375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109753]
Predicted Effect probably benign
Transcript: ENSMUST00000109753
AA Change: S9T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105375
Gene: ENSMUSG00000078998
AA Change: S9T

signal peptide 1 19 N/A INTRINSIC
Pfam:LBP_BPI_CETP 176 319 1.4e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Bpifa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Bpifa6 APN 2 153990466 missense probably benign 0.00
IGL01805:Bpifa6 APN 2 153984912 missense probably benign 0.03
IGL02246:Bpifa6 APN 2 153989276 missense probably damaging 0.98
IGL02275:Bpifa6 APN 2 153992272 missense probably benign 0.40
IGL02405:Bpifa6 APN 2 153990862 nonsense probably null
IGL02587:Bpifa6 APN 2 153989210 missense probably damaging 0.99
IGL03365:Bpifa6 APN 2 153989284 missense possibly damaging 0.71
F6893:Bpifa6 UTSW 2 153987158 missense probably damaging 1.00
FR4976:Bpifa6 UTSW 2 153986376 missense probably benign
FR4976:Bpifa6 UTSW 2 153986398 missense probably benign
R0131:Bpifa6 UTSW 2 153982931 missense probably benign 0.11
R0131:Bpifa6 UTSW 2 153982931 missense probably benign 0.11
R0799:Bpifa6 UTSW 2 153992272 missense probably benign 0.40
R1468:Bpifa6 UTSW 2 153989272 missense probably benign 0.01
R1468:Bpifa6 UTSW 2 153989272 missense probably benign 0.01
R1767:Bpifa6 UTSW 2 153987227 missense possibly damaging 0.95
R2255:Bpifa6 UTSW 2 153990895 missense probably damaging 0.98
R2857:Bpifa6 UTSW 2 153989274 missense probably benign 0.03
R3430:Bpifa6 UTSW 2 153989251 missense probably benign 0.00
R4616:Bpifa6 UTSW 2 153982988 missense possibly damaging 0.47
R5420:Bpifa6 UTSW 2 153989330 missense probably damaging 0.98
R6224:Bpifa6 UTSW 2 153987153 missense probably damaging 0.99
R6483:Bpifa6 UTSW 2 153990434 missense probably benign 0.13
R6552:Bpifa6 UTSW 2 153987158 missense probably damaging 0.99
R7061:Bpifa6 UTSW 2 153992316 missense probably benign 0.00
R7378:Bpifa6 UTSW 2 153986433 missense probably damaging 0.99
R7472:Bpifa6 UTSW 2 153989329 missense possibly damaging 0.93
R8313:Bpifa6 UTSW 2 153989258 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cattcccataccttatttcttccc -3'
Posted On2013-04-11