Mutagenetix > Incidental Mutation

Incidental Mutation 'R1946:Dsg2'

216720

Institutional Source

Beutler Lab

Gene Symbol

Dsg2

Ensembl Gene

ENSMUSG00000044393

Gene Name

desmoglein 2

Synonyms

D18Ertd293e

MMRRC Submission

039964-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R1946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20558074-20604521 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20580548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 192 (D192G)

Ref Sequence

ENSEMBL: ENSMUSP00000113029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102] [ENSMUST00000121837]

AlphaFold

O55111

Predicted Effect

probably damaging
Transcript: ENSMUST00000059787
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: D192G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120102
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393
AA Change: D192G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
Pfam:Cadherin	282	347	6.9e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121837
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113029
Gene: ENSMUSG00000044393
AA Change: D192G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adamts5	C	A	16: 85,899,243	C342F	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Aen	G	C	7: 78,902,672	E32Q	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgap44	A	G	11: 65,012,096	M509T	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
Bmpr2	T	C	1: 59,868,397	V883A	possibly damaging	Het
Bpifa1	A	T	2: 154,145,634	I135F	probably damaging	Het
Bsn	A	G	9: 108,114,651	F1301L	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Ccdc18	A	G	5: 108,228,995	E1434G	probably damaging	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Cpn1	G	A	19: 43,956,518	T450M	probably benign	Het
Dlg4	A	G	11: 70,039,575	Y432C	probably damaging	Het
Dnah8	C	A	17: 30,712,385	T1458K	probably benign	Het
Dock5	A	T	14: 67,786,316	M1132K	probably damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fndc11	A	T	2: 181,221,834	D144V	probably benign	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Ganab	T	A	19: 8,910,808	D439E	probably damaging	Het
Gm10228	C	A	16: 89,041,353	G21V	unknown	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gm9573	A	T	17: 35,622,524		probably benign	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Gsdmc4	C	A	15: 63,902,780	D51Y	probably benign	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Kcnq2	T	A	2: 181,088,451	D446V	probably benign	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Lrrcc1	A	G	3: 14,550,393	R394G	probably benign	Het
Lrrk2	G	A	15: 91,736,661		probably null	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Msrb3	A	G	10: 120,852,008	V54A	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Ncor2	G	A	5: 125,034,412	T1314I	probably damaging	Het
Nes	A	G	3: 87,978,514	Q1316R	possibly damaging	Het
Nfe2l3	A	C	6: 51,457,315	Q285P	probably damaging	Het
Nkd1	C	T	8: 88,592,117	H357Y	probably damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Olfr1333	T	C	4: 118,830,026	N139S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr1469	T	C	19: 13,410,779	V70A	possibly damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Otx1	G	T	11: 21,998,482	T46K	probably damaging	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Pcdhb16	T	A	18: 37,478,899	L304*	probably null	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Ppp1r12b	A	G	1: 134,892,270	V245A	probably damaging	Het
Ppp2r2d	A	G	7: 138,868,467	D19G	probably damaging	Het
Rimbp3	G	A	16: 17,210,427	V572I	probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Sulf1	T	C	1: 12,796,907	V105A	probably benign	Het
Syngr3	T	C	17: 24,687,706	N45S	probably benign	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Usf2	T	C	7: 30,956,238	T1A	probably null	Het
Vill	A	T	9: 119,058,492	H108L	probably benign	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het
Zfp24	AC	A	18: 24,014,419		probably null	Het

Other mutations in Dsg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dsg2	APN	18	20601769	missense	probably benign	0.10
IGL00979:Dsg2	APN	18	20582767	missense	probably damaging	0.99
IGL01081:Dsg2	APN	18	20589942	unclassified	probably benign
IGL01358:Dsg2	APN	18	20601793	missense	probably damaging	0.98
IGL02002:Dsg2	APN	18	20579176	missense	probably damaging	1.00
IGL02263:Dsg2	APN	18	20590020	missense	possibly damaging	0.70
IGL02410:Dsg2	APN	18	20602132	missense	probably benign	0.04
IGL02553:Dsg2	APN	18	20592410	missense	probably damaging	1.00
IGL03036:Dsg2	APN	18	20579077	missense	probably damaging	0.99
dissolute	UTSW	18	20595951	splice site	probably null
Dysjunction	UTSW	18	20582939	nonsense	probably null
weg	UTSW	18	20580651	nonsense	probably null
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0112:Dsg2	UTSW	18	20583042	missense	probably benign	0.02
R0305:Dsg2	UTSW	18	20582695	splice site	probably benign
R0380:Dsg2	UTSW	18	20582939	nonsense	probably null
R0401:Dsg2	UTSW	18	20592508	splice site	probably benign
R0421:Dsg2	UTSW	18	20579391	missense	probably damaging	1.00
R0578:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R0667:Dsg2	UTSW	18	20573499	missense	possibly damaging	0.50
R1223:Dsg2	UTSW	18	20573493	missense	probably benign	0.23
R1433:Dsg2	UTSW	18	20582723	missense	probably damaging	0.98
R1543:Dsg2	UTSW	18	20594211	missense	probably benign	0.33
R1730:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1783:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1991:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R1992:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R2027:Dsg2	UTSW	18	20583004	unclassified	probably benign
R2109:Dsg2	UTSW	18	20592289	missense	probably benign	0.00
R2143:Dsg2	UTSW	18	20579161	missense	probably damaging	1.00
R2201:Dsg2	UTSW	18	20596054	missense	probably damaging	1.00
R2343:Dsg2	UTSW	18	20602298	missense	probably damaging	0.99
R2937:Dsg2	UTSW	18	20579128	missense	probably damaging	1.00
R3710:Dsg2	UTSW	18	20602117	missense	probably damaging	1.00
R3734:Dsg2	UTSW	18	20601947	missense	probably benign	0.41
R3773:Dsg2	UTSW	18	20591862	missense	probably damaging	1.00
R4176:Dsg2	UTSW	18	20580663	missense	probably benign	0.25
R4213:Dsg2	UTSW	18	20598514	missense	probably benign	0.01
R4299:Dsg2	UTSW	18	20595951	splice site	probably null
R4515:Dsg2	UTSW	18	20601387	missense	probably benign
R4649:Dsg2	UTSW	18	20602245	missense	possibly damaging	0.56
R4940:Dsg2	UTSW	18	20579430	missense	probably damaging	1.00
R4949:Dsg2	UTSW	18	20590184	missense	probably damaging	1.00
R4998:Dsg2	UTSW	18	20601521	missense	probably benign	0.26
R5078:Dsg2	UTSW	18	20596083	critical splice donor site	probably null
R5155:Dsg2	UTSW	18	20598658	missense	possibly damaging	0.67
R5398:Dsg2	UTSW	18	20579133	missense	probably benign	0.45
R5503:Dsg2	UTSW	18	20580651	nonsense	probably null
R6133:Dsg2	UTSW	18	20590089	missense	probably benign	0.00
R6163:Dsg2	UTSW	18	20598669	critical splice donor site	probably null
R6226:Dsg2	UTSW	18	20579449	missense	probably damaging	0.98
R6228:Dsg2	UTSW	18	20594293	critical splice donor site	probably null
R6241:Dsg2	UTSW	18	20590217	splice site	probably null
R6482:Dsg2	UTSW	18	20601314	missense	possibly damaging	0.69
R6524:Dsg2	UTSW	18	20583036	missense	probably damaging	1.00
R6856:Dsg2	UTSW	18	20601802	missense	probably damaging	0.98
R7058:Dsg2	UTSW	18	20592275	missense	probably benign	0.00
R7108:Dsg2	UTSW	18	20601863	missense	probably damaging	1.00
R7149:Dsg2	UTSW	18	20579454	missense	probably damaging	0.98
R7207:Dsg2	UTSW	18	20601459	missense	probably damaging	0.99
R7256:Dsg2	UTSW	18	20591931	missense	possibly damaging	0.96
R7315:Dsg2	UTSW	18	20579160	missense	probably damaging	0.97
R7471:Dsg2	UTSW	18	20580618	missense	probably benign	0.08
R7558:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R8094:Dsg2	UTSW	18	20583004	unclassified	probably benign
R8118:Dsg2	UTSW	18	20582801	missense	probably benign	0.11
R8157:Dsg2	UTSW	18	20580549	missense	probably damaging	1.00
R8307:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8308:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8488:Dsg2	UTSW	18	20601374	missense	probably damaging	1.00
R8520:Dsg2	UTSW	18	20579451	missense	probably damaging	1.00
R8669:Dsg2	UTSW	18	20590075	missense	probably damaging	1.00
R8675:Dsg2	UTSW	18	20601918	missense	possibly damaging	0.75
R8750:Dsg2	UTSW	18	20575012	missense	possibly damaging	0.90
R8773:Dsg2	UTSW	18	20582999	missense	probably damaging	1.00
R8888:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8895:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8912:Dsg2	UTSW	18	20582821	missense	probably damaging	1.00
R8925:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R8927:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R9263:Dsg2	UTSW	18	20594166	missense	probably benign	0.33
R9328:Dsg2	UTSW	18	20582790	missense	possibly damaging	0.81
Z1176:Dsg2	UTSW	18	20580621	missense	probably damaging	1.00
Z1177:Dsg2	UTSW	18	20602249	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAGGGGCATGAATGGTTC -3'
(R):5'- TTCCATGAGTGAGGAATACAGAGC -3'

Sequencing Primer
(F):5'- AGGATTGCTCTCAGTTCAGCAGAC -3'
(R):5'- TTAGAACATAAAAATCGAGGGAGTG -3'

Posted On

2014-08-01