Incidental Mutation 'R0132:Abcc12'
ID21692
Institutional Source Beutler Lab
Gene Symbol Abcc12
Ensembl Gene ENSMUSG00000036872
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms4930467B22Rik, MRP9
MMRRC Submission 038417-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0132 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location86482260-86580686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86531568 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 773 (I773T)
Ref Sequence ENSEMBL: ENSMUSP00000122402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080115] [ENSMUST00000129898] [ENSMUST00000131423] [ENSMUST00000131806] [ENSMUST00000152438] [ENSMUST00000156610]
Predicted Effect probably benign
Transcript: ENSMUST00000080115
AA Change: I773T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079014
Gene: ENSMUSG00000036872
AA Change: I773T

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 3.6e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 791 1079 1.3e-26 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129898
SMART Domains Protein: ENSMUSP00000122577
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131423
AA Change: I773T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122402
Gene: ENSMUSG00000036872
AA Change: I773T

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.1e-21 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 792 1077 1.6e-34 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131806
SMART Domains Protein: ENSMUSP00000116866
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.3e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152438
SMART Domains Protein: ENSMUSP00000114582
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156066
AA Change: I58T
SMART Domains Protein: ENSMUSP00000120282
Gene: ENSMUSG00000036872
AA Change: I58T

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:ABC_membrane 78 363 3.8e-35 PFAM
Pfam:ABC_tran 430 508 5.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156610
SMART Domains Protein: ENSMUSP00000123578
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 5.9e-20 PFAM
AAA 506 661 1.07e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Abcc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Abcc12 APN 8 86534693 missense probably benign 0.45
IGL01504:Abcc12 APN 8 86557602 missense probably damaging 1.00
IGL01593:Abcc12 APN 8 86557650 missense probably damaging 1.00
IGL02164:Abcc12 APN 8 86527404 missense probably damaging 1.00
IGL02173:Abcc12 APN 8 86566442 missense probably damaging 1.00
IGL02175:Abcc12 APN 8 86535013 splice site probably null
IGL02405:Abcc12 APN 8 86558153 missense probably damaging 0.98
IGL02620:Abcc12 APN 8 86505314 splice site probably null
IGL02635:Abcc12 APN 8 86509682 splice site probably benign
IGL03241:Abcc12 APN 8 86509807 missense possibly damaging 0.77
PIT4544001:Abcc12 UTSW 8 86505246 missense possibly damaging 0.58
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0116:Abcc12 UTSW 8 86534998 missense probably benign 0.00
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0308:Abcc12 UTSW 8 86557752 splice site probably benign
R0589:Abcc12 UTSW 8 86560472 missense possibly damaging 0.86
R1451:Abcc12 UTSW 8 86557693 missense probably damaging 1.00
R1564:Abcc12 UTSW 8 86517486 missense probably benign 0.10
R1740:Abcc12 UTSW 8 86505497 nonsense probably null
R1740:Abcc12 UTSW 8 86509771 missense possibly damaging 0.78
R1970:Abcc12 UTSW 8 86527281 missense probably benign 0.27
R2017:Abcc12 UTSW 8 86563988 missense probably damaging 1.00
R2026:Abcc12 UTSW 8 86558233 missense probably benign 0.30
R2402:Abcc12 UTSW 8 86509141 missense probably damaging 1.00
R3085:Abcc12 UTSW 8 86543907 splice site probably benign
R3115:Abcc12 UTSW 8 86540024 critical splice donor site probably null
R3176:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3276:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3847:Abcc12 UTSW 8 86553391 missense probably benign 0.05
R3911:Abcc12 UTSW 8 86528419 splice site probably benign
R4031:Abcc12 UTSW 8 86517448 missense probably damaging 1.00
R4297:Abcc12 UTSW 8 86531525 splice site probably null
R4298:Abcc12 UTSW 8 86531525 splice site probably null
R4299:Abcc12 UTSW 8 86531525 splice site probably null
R4688:Abcc12 UTSW 8 86548694 missense possibly damaging 0.46
R4810:Abcc12 UTSW 8 86560842 missense probably damaging 1.00
R4863:Abcc12 UTSW 8 86538376 missense probably damaging 1.00
R4892:Abcc12 UTSW 8 86509802 missense probably benign 0.28
R5288:Abcc12 UTSW 8 86566539 missense probably damaging 1.00
R5303:Abcc12 UTSW 8 86509786 missense probably benign 0.15
R5332:Abcc12 UTSW 8 86524830 splice site probably null
R5386:Abcc12 UTSW 8 86517489 missense possibly damaging 0.82
R5457:Abcc12 UTSW 8 86509844 missense probably benign 0.03
R5900:Abcc12 UTSW 8 86566520 missense possibly damaging 0.90
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6291:Abcc12 UTSW 8 86566544 missense possibly damaging 0.72
R6518:Abcc12 UTSW 8 86509089
R6677:Abcc12 UTSW 8 86534752 missense possibly damaging 0.58
R7258:Abcc12 UTSW 8 86560857 missense possibly damaging 0.94
R7411:Abcc12 UTSW 8 86560850 missense possibly damaging 0.95
R7619:Abcc12 UTSW 8 86566553 missense probably damaging 1.00
R7808:Abcc12 UTSW 8 86507939 missense probably benign 0.03
R7828:Abcc12 UTSW 8 86528275 missense probably benign 0.08
R7834:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7834:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
R7917:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7917:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
X0027:Abcc12 UTSW 8 86553291 missense probably damaging 0.99
Z1088:Abcc12 UTSW 8 86560279 synonymous probably null
Z1176:Abcc12 UTSW 8 86550601 missense probably damaging 1.00
Z1177:Abcc12 UTSW 8 86527384 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAATGGCTTCTGACTACTGCCCAC -3'
(R):5'- TTAGGCTTCAAGTCACACGCCC -3'

Sequencing Primer
(F):5'- CAGAACCTGGCAGCTTTAATG -3'
(R):5'- TAGACCATTGAAAGTGTGTGAAAAAC -3'
Posted On2013-04-11