Mutagenetix > Incidental Mutation

Incidental Mutation 'R1962:Igf1r'

216974

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

039976-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1962 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68207275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 995 (V995A)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005671
AA Change: V995A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: V995A

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208731

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208871

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	G	7: 120,341,245	I354M	probably damaging	Het
Abca8a	T	C	11: 110,026,905		probably null	Het
Abca8b	T	C	11: 109,979,898	R143G	probably benign	Het
Actn4	T	C	7: 28,894,622	D840G	probably damaging	Het
Agpat5	T	C	8: 18,878,010	L197P	probably damaging	Het
Akr1d1	T	C	6: 37,536,048	V93A	probably benign	Het
Arap2	T	C	5: 62,676,664	K820R	possibly damaging	Het
Armc9	T	A	1: 86,207,974	C551S	probably damaging	Het
Atg7	T	C	6: 114,706,230	L418P	probably damaging	Het
Awat2	G	A	X: 100,404,559	P148S	probably damaging	Het
Brms1	C	T	19: 5,045,999	R34W	probably damaging	Het
Cbx2	A	G	11: 119,028,569	Q320R	possibly damaging	Het
Ccdc106	G	A	7: 5,059,540	D11N	possibly damaging	Het
Ccdc30	C	T	4: 119,339,791	R426Q	probably benign	Het
Cdc42bpg	T	A	19: 6,306,855	V47E	probably damaging	Het
Cep170b	C	T	12: 112,738,061	S751L	probably damaging	Het
Cfap46	A	T	7: 139,667,041	L328Q	probably damaging	Het
Crtc3	A	G	7: 80,589,931	F558L	probably damaging	Het
Cyp2d34	A	G	15: 82,618,608	V139A	probably benign	Het
Dchs1	A	G	7: 105,764,201	Y1136H	probably damaging	Het
Dhrs4	T	C	14: 55,487,603	V185A	probably damaging	Het
Dnah7b	A	G	1: 46,242,103	K2775E	possibly damaging	Het
Dst	C	A	1: 34,191,016	S2238R	possibly damaging	Het
Duox2	T	C	2: 122,297,372		probably null	Het
Dusp16	G	T	6: 134,718,136	Y577*	probably null	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Eml5	A	G	12: 98,876,311	F176S	probably damaging	Het
Esco2	C	A	14: 65,831,533	R109S	probably damaging	Het
Galnt7	C	T	8: 57,532,714	E541K	probably benign	Het
Gbf1	C	T	19: 46,267,219	T707I	probably damaging	Het
Gdf5	A	G	2: 155,941,752	C427R	probably damaging	Het
Glyctk	T	C	9: 106,157,865	M1V	probably null	Het
Gm5478	T	C	15: 101,644,395	E367G	probably damaging	Het
Gm9268	T	C	7: 43,047,400	V620A	probably benign	Het
Golga7b	G	A	19: 42,263,329	V5I	probably benign	Het
Gpt2	T	C	8: 85,493,135	L70P	probably damaging	Het
Gsdmc3	C	A	15: 63,858,466	Q416H	probably damaging	Het
Hoxb5	A	G	11: 96,304,092	E160G	probably benign	Het
Ift81	A	T	5: 122,560,709	Y532N	probably benign	Het
Igf1	G	A	10: 87,864,864	C66Y	probably damaging	Het
Ip6k1	T	C	9: 108,041,088		probably null	Het
Jaml	T	C	9: 45,104,197	I333T	possibly damaging	Het
Kdm4c	T	C	4: 74,307,016		probably benign	Het
Kdm6b	T	C	11: 69,401,365		probably benign	Het
Krt6a	C	T	15: 101,691,465	R404H	probably damaging	Het
Larp4b	C	A	13: 9,136,842	H69N	probably benign	Het
Lcat	A	T	8: 105,941,723	W222R	probably damaging	Het
Lrrc40	T	A	3: 158,040,449	C54S	probably benign	Het
Mcpt9	T	A	14: 56,027,567	H159L	probably benign	Het
Megf8	T	C	7: 25,363,551	V2444A	probably damaging	Het
Memo1	T	C	17: 74,245,008	T98A	possibly damaging	Het
Micalcl	A	T	7: 112,412,844	I634L	probably benign	Het
Mov10	C	T	3: 104,796,977	R835Q	probably damaging	Het
Mybpc1	A	T	10: 88,548,826	L546Q	probably damaging	Het
Myo6	T	C	9: 80,260,835	V427A	probably damaging	Het
Myom2	T	A	8: 15,132,599		probably null	Het
Mzt2	G	A	16: 15,848,679	R125C	probably damaging	Het
Neb	T	A	2: 52,272,937	R2031*	probably null	Het
Nphp3	T	C	9: 104,021,338	S447P	probably benign	Het
Nrp2	T	A	1: 62,718,931	D25E	probably benign	Het
Nts	A	G	10: 102,485,057	L57S	probably damaging	Het
Nudt9	G	A	5: 104,065,105	R348H	probably benign	Het
Olfr1299	T	C	2: 111,664,889	I221T	probably damaging	Het
Olfr198	T	A	16: 59,201,908	I173F	possibly damaging	Het
Olfr211	C	T	6: 116,493,764	P52S	probably benign	Het
Olfr401	C	A	11: 74,121,824	D178E	probably benign	Het
Olfr976	T	C	9: 39,956,683	Y84C	probably benign	Het
Pafah1b1	T	C	11: 74,699,351		probably benign	Het
Piezo2	C	A	18: 63,078,840	M1291I	probably damaging	Het
Pik3ca	T	C	3: 32,443,867	F486S	probably benign	Het
Podnl1	C	T	8: 84,127,297	H99Y	probably benign	Het
Prdm6	A	T	18: 53,568,161	Y341F	probably damaging	Het
Prr5l	C	T	2: 101,758,509		probably null	Het
Psmd4	G	T	3: 95,036,701	T24N	possibly damaging	Het
Rbbp8nl	G	A	2: 180,280,874	T242M	probably benign	Het
Rsf1	GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC	GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,906		probably benign	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Scfd1	T	C	12: 51,422,986	V438A	probably benign	Het
Scn9a	A	G	2: 66,484,311	C1677R	probably damaging	Het
Sgsm2	T	A	11: 74,892,028	H34L	probably damaging	Het
Shank1	T	A	7: 44,344,323		probably null	Het
Smarca2	G	T	19: 26,672,724	E24*	probably null	Het
Sncaip	C	T	18: 52,871,362	H354Y	probably damaging	Het
St8sia2	T	A	7: 73,943,309	D333V	probably damaging	Het
Stxbp2	C	A	8: 3,642,672	R575S	probably benign	Het
Syt9	T	A	7: 107,425,107	V69D	probably damaging	Het
Tanc2	A	G	11: 105,798,732	N240S	probably benign	Het
Tcl1b1	T	C	12: 105,164,468	L70S	probably benign	Het
Tmem44	C	T	16: 30,543,401		probably null	Het
Tor1b	A	G	2: 30,956,919	R293G	probably benign	Het
Trim29	T	C	9: 43,311,318	V148A	probably benign	Het
Trmt10b	C	A	4: 45,314,378	Y271*	probably null	Het
Ubqln5	A	T	7: 104,128,888	V243E	possibly damaging	Het
Ubqln5	T	C	7: 104,128,927	D230G	probably damaging	Het
Ugt2b37	A	G	5: 87,254,334	F146S	probably damaging	Het
Vmn1r160	T	A	7: 22,871,402	V60E	probably damaging	Het
Vmn2r109	T	A	17: 20,553,923	D390V	probably damaging	Het
Vmn2r27	C	T	6: 124,223,834	R388Q	possibly damaging	Het
Vmn2r72	A	T	7: 85,749,161	V537D	probably benign	Het
Vmn2r84	A	G	10: 130,390,722	S416P	probably damaging	Het
Vmn2r98	C	A	17: 19,065,333	Y138*	probably null	Het
Xrra1	A	C	7: 99,911,020	E401A	probably damaging	Het
Zfp280d	T	A	9: 72,335,080	C688*	probably null	Het
Zfp3	T	A	11: 70,772,128	Y304*	probably null	Het
Zfp407	A	T	18: 84,559,336	D1217E	probably benign	Het
Zfp658	T	C	7: 43,573,821	Y507H	possibly damaging	Het
Zfyve16	T	C	13: 92,522,744	T220A	possibly damaging	Het
Zmym4	C	G	4: 126,902,670	K820N	possibly damaging	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	68207806	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	68004317	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AAAGGAACCACTGTTGTTTGG -3'
(R):5'- AGGCCTCGTTGAGAAACTCG -3'

Sequencing Primer
(F):5'- GGTTCTTAGCTACGAGTACCAC -3'
(R):5'- GAGAAACTCGATTCTTTCACGC -3'

Posted On

2014-08-01