Incidental Mutation 'R1962:Igf1r'
ID 216974
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms IGF-1R, line 186, A330103N21Rik, hyft, CD221
MMRRC Submission 039976-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1962 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 67602575-67883416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67857023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 995 (V995A)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005671
AA Change: V995A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: V995A

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208871
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 119,940,468 (GRCm39) I354M probably damaging Het
Abca8a T C 11: 109,917,731 (GRCm39) probably null Het
Abca8b T C 11: 109,870,724 (GRCm39) R143G probably benign Het
Actn4 T C 7: 28,594,047 (GRCm39) D840G probably damaging Het
Agpat5 T C 8: 18,928,026 (GRCm39) L197P probably damaging Het
Akr1d1 T C 6: 37,512,983 (GRCm39) V93A probably benign Het
Arap2 T C 5: 62,834,007 (GRCm39) K820R possibly damaging Het
Armc9 T A 1: 86,135,696 (GRCm39) C551S probably damaging Het
Atg7 T C 6: 114,683,191 (GRCm39) L418P probably damaging Het
Awat2 G A X: 99,448,165 (GRCm39) P148S probably damaging Het
Brms1 C T 19: 5,096,027 (GRCm39) R34W probably damaging Het
Cbx2 A G 11: 118,919,395 (GRCm39) Q320R possibly damaging Het
Ccdc106 G A 7: 5,062,539 (GRCm39) D11N possibly damaging Het
Ccdc30 C T 4: 119,196,988 (GRCm39) R426Q probably benign Het
Cdc42bpg T A 19: 6,356,885 (GRCm39) V47E probably damaging Het
Cep170b C T 12: 112,704,495 (GRCm39) S751L probably damaging Het
Cfap46 A T 7: 139,246,957 (GRCm39) L328Q probably damaging Het
Crtc3 A G 7: 80,239,679 (GRCm39) F558L probably damaging Het
Cyp2d34 A G 15: 82,502,809 (GRCm39) V139A probably benign Het
Dchs1 A G 7: 105,413,408 (GRCm39) Y1136H probably damaging Het
Dhrs4 T C 14: 55,725,060 (GRCm39) V185A probably damaging Het
Dnah7b A G 1: 46,281,263 (GRCm39) K2775E possibly damaging Het
Dst C A 1: 34,230,097 (GRCm39) S2238R possibly damaging Het
Duox2 T C 2: 122,127,853 (GRCm39) probably null Het
Dusp16 G T 6: 134,695,099 (GRCm39) Y577* probably null Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Eml5 A G 12: 98,842,570 (GRCm39) F176S probably damaging Het
Esco2 C A 14: 66,068,982 (GRCm39) R109S probably damaging Het
Galnt7 C T 8: 57,985,748 (GRCm39) E541K probably benign Het
Gbf1 C T 19: 46,255,658 (GRCm39) T707I probably damaging Het
Gdf5 A G 2: 155,783,672 (GRCm39) C427R probably damaging Het
Glyctk T C 9: 106,035,064 (GRCm39) M1V probably null Het
Gm5478 T C 15: 101,552,830 (GRCm39) E367G probably damaging Het
Golga7b G A 19: 42,251,768 (GRCm39) V5I probably benign Het
Gpt2 T C 8: 86,219,764 (GRCm39) L70P probably damaging Het
Gsdmc3 C A 15: 63,730,315 (GRCm39) Q416H probably damaging Het
Hoxb5 A G 11: 96,194,918 (GRCm39) E160G probably benign Het
Ift81 A T 5: 122,698,772 (GRCm39) Y532N probably benign Het
Igf1 G A 10: 87,700,726 (GRCm39) C66Y probably damaging Het
Ip6k1 T C 9: 107,918,287 (GRCm39) probably null Het
Jaml T C 9: 45,015,495 (GRCm39) I333T possibly damaging Het
Kdm4c T C 4: 74,225,253 (GRCm39) probably benign Het
Kdm6b T C 11: 69,292,191 (GRCm39) probably benign Het
Krt6a C T 15: 101,599,900 (GRCm39) R404H probably damaging Het
Larp4b C A 13: 9,186,878 (GRCm39) H69N probably benign Het
Lcat A T 8: 106,668,355 (GRCm39) W222R probably damaging Het
Lrrc40 T A 3: 157,746,086 (GRCm39) C54S probably benign Het
Mcpt9 T A 14: 56,265,024 (GRCm39) H159L probably benign Het
Megf8 T C 7: 25,062,976 (GRCm39) V2444A probably damaging Het
Memo1 T C 17: 74,552,003 (GRCm39) T98A possibly damaging Het
Mical2 A T 7: 112,012,051 (GRCm39) I634L probably benign Het
Mov10 C T 3: 104,704,293 (GRCm39) R835Q probably damaging Het
Mybpc1 A T 10: 88,384,688 (GRCm39) L546Q probably damaging Het
Myo6 T C 9: 80,168,117 (GRCm39) V427A probably damaging Het
Myom2 T A 8: 15,182,599 (GRCm39) probably null Het
Mzt2 G A 16: 15,666,543 (GRCm39) R125C probably damaging Het
Neb T A 2: 52,162,949 (GRCm39) R2031* probably null Het
Nphp3 T C 9: 103,898,537 (GRCm39) S447P probably benign Het
Nrp2 T A 1: 62,758,090 (GRCm39) D25E probably benign Het
Nts A G 10: 102,320,918 (GRCm39) L57S probably damaging Het
Nudt9 G A 5: 104,212,971 (GRCm39) R348H probably benign Het
Or10d5j T C 9: 39,867,979 (GRCm39) Y84C probably benign Het
Or13a1 C T 6: 116,470,725 (GRCm39) P52S probably benign Het
Or3a1b C A 11: 74,012,650 (GRCm39) D178E probably benign Het
Or4k49 T C 2: 111,495,234 (GRCm39) I221T probably damaging Het
Or5ac16 T A 16: 59,022,271 (GRCm39) I173F possibly damaging Het
Pafah1b1 T C 11: 74,590,177 (GRCm39) probably benign Het
Piezo2 C A 18: 63,211,911 (GRCm39) M1291I probably damaging Het
Pik3ca T C 3: 32,498,016 (GRCm39) F486S probably benign Het
Podnl1 C T 8: 84,853,926 (GRCm39) H99Y probably benign Het
Prdm6 A T 18: 53,701,233 (GRCm39) Y341F probably damaging Het
Prr5l C T 2: 101,588,854 (GRCm39) probably null Het
Psmd4 G T 3: 94,944,012 (GRCm39) T24N possibly damaging Het
Rbbp8nl G A 2: 179,922,667 (GRCm39) T242M probably benign Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,229,113 (GRCm39) probably benign Het
Scfd1 T C 12: 51,469,769 (GRCm39) V438A probably benign Het
Scn9a A G 2: 66,314,655 (GRCm39) C1677R probably damaging Het
Sgsm2 T A 11: 74,782,854 (GRCm39) H34L probably damaging Het
Shank1 T A 7: 43,993,747 (GRCm39) probably null Het
Smarca2 G T 19: 26,650,124 (GRCm39) E24* probably null Het
Sncaip C T 18: 53,004,434 (GRCm39) H354Y probably damaging Het
St8sia2 T A 7: 73,593,057 (GRCm39) D333V probably damaging Het
Stxbp2 C A 8: 3,692,672 (GRCm39) R575S probably benign Het
Syt9 T A 7: 107,024,314 (GRCm39) V69D probably damaging Het
Tanc2 A G 11: 105,689,558 (GRCm39) N240S probably benign Het
Tcl1b1 T C 12: 105,130,727 (GRCm39) L70S probably benign Het
Tmem44 C T 16: 30,362,219 (GRCm39) probably null Het
Tor1b A G 2: 30,846,931 (GRCm39) R293G probably benign Het
Trim29 T C 9: 43,222,615 (GRCm39) V148A probably benign Het
Trmt10b C A 4: 45,314,378 (GRCm39) Y271* probably null Het
Ubqln5 A T 7: 103,778,095 (GRCm39) V243E possibly damaging Het
Ubqln5 T C 7: 103,778,134 (GRCm39) D230G probably damaging Het
Ugt2b37 A G 5: 87,402,193 (GRCm39) F146S probably damaging Het
Vmn1r160 T A 7: 22,570,827 (GRCm39) V60E probably damaging Het
Vmn2r109 T A 17: 20,774,185 (GRCm39) D390V probably damaging Het
Vmn2r27 C T 6: 124,200,793 (GRCm39) R388Q possibly damaging Het
Vmn2r72 A T 7: 85,398,369 (GRCm39) V537D probably benign Het
Vmn2r84 A G 10: 130,226,591 (GRCm39) S416P probably damaging Het
Vmn2r98 C A 17: 19,285,595 (GRCm39) Y138* probably null Het
Vmn2r-ps158 T C 7: 42,696,824 (GRCm39) V620A probably benign Het
Xrra1 A C 7: 99,560,227 (GRCm39) E401A probably damaging Het
Zfp280d T A 9: 72,242,362 (GRCm39) C688* probably null Het
Zfp3 T A 11: 70,662,954 (GRCm39) Y304* probably null Het
Zfp407 A T 18: 84,577,461 (GRCm39) D1217E probably benign Het
Zfp658 T C 7: 43,223,245 (GRCm39) Y507H possibly damaging Het
Zfyve16 T C 13: 92,659,252 (GRCm39) T220A possibly damaging Het
Zmym4 C G 4: 126,796,463 (GRCm39) K820N possibly damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 67,839,771 (GRCm39) missense probably benign
IGL00837:Igf1r APN 7 67,851,100 (GRCm39) splice site probably benign
IGL01515:Igf1r APN 7 67,857,200 (GRCm39) missense probably damaging 1.00
IGL01572:Igf1r APN 7 67,843,189 (GRCm39) missense probably benign 0.01
IGL02100:Igf1r APN 7 67,839,706 (GRCm39) missense probably benign 0.05
IGL02506:Igf1r APN 7 67,843,144 (GRCm39) missense probably benign
IGL02672:Igf1r APN 7 67,839,781 (GRCm39) missense probably benign 0.05
IGL02701:Igf1r APN 7 67,850,997 (GRCm39) missense possibly damaging 0.93
IGL02742:Igf1r APN 7 67,839,739 (GRCm39) missense possibly damaging 0.94
IGL03073:Igf1r APN 7 67,864,791 (GRCm39) missense probably damaging 1.00
IGL03257:Igf1r APN 7 67,864,688 (GRCm39) missense probably damaging 1.00
Frufru UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
Hungarian UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
Mimi UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
Piroshka UTSW 7 67,857,084 (GRCm39) nonsense probably null
Romanian UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
Sublime UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
Toy UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
BB009:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
BB019:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4737:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
PIT4445001:Igf1r UTSW 7 67,857,211 (GRCm39) missense probably damaging 1.00
R0003:Igf1r UTSW 7 67,814,990 (GRCm39) missense probably damaging 1.00
R0184:Igf1r UTSW 7 67,875,941 (GRCm39) missense possibly damaging 0.84
R0538:Igf1r UTSW 7 67,857,574 (GRCm39) missense probably damaging 1.00
R0632:Igf1r UTSW 7 67,814,903 (GRCm39) missense probably damaging 1.00
R0727:Igf1r UTSW 7 67,861,906 (GRCm39) critical splice donor site probably null
R0750:Igf1r UTSW 7 67,861,839 (GRCm39) missense probably damaging 0.99
R1104:Igf1r UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
R1169:Igf1r UTSW 7 67,814,875 (GRCm39) missense probably benign 0.00
R1348:Igf1r UTSW 7 67,868,216 (GRCm39) missense probably damaging 1.00
R1471:Igf1r UTSW 7 67,653,585 (GRCm39) missense probably damaging 0.98
R1580:Igf1r UTSW 7 67,857,617 (GRCm39) missense probably benign
R1745:Igf1r UTSW 7 67,819,661 (GRCm39) missense probably damaging 1.00
R1772:Igf1r UTSW 7 67,844,822 (GRCm39) missense probably benign 0.03
R1789:Igf1r UTSW 7 67,864,681 (GRCm39) nonsense probably null
R1823:Igf1r UTSW 7 67,844,729 (GRCm39) missense possibly damaging 0.77
R1902:Igf1r UTSW 7 67,850,997 (GRCm39) missense possibly damaging 0.93
R2179:Igf1r UTSW 7 67,653,698 (GRCm39) missense probably damaging 0.99
R2215:Igf1r UTSW 7 67,814,982 (GRCm39) missense probably benign
R2221:Igf1r UTSW 7 67,851,710 (GRCm39) missense probably damaging 1.00
R2233:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2234:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2235:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R3023:Igf1r UTSW 7 67,833,147 (GRCm39) missense probably benign 0.00
R4044:Igf1r UTSW 7 67,839,810 (GRCm39) missense possibly damaging 0.83
R4226:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R4387:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4388:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4728:Igf1r UTSW 7 67,839,372 (GRCm39) missense probably damaging 1.00
R4781:Igf1r UTSW 7 67,814,947 (GRCm39) missense possibly damaging 0.75
R5254:Igf1r UTSW 7 67,857,067 (GRCm39) missense probably damaging 0.99
R5278:Igf1r UTSW 7 67,843,166 (GRCm39) missense possibly damaging 0.78
R5510:Igf1r UTSW 7 67,843,107 (GRCm39) missense probably benign 0.19
R5522:Igf1r UTSW 7 67,833,258 (GRCm39) missense probably damaging 0.96
R5527:Igf1r UTSW 7 67,857,569 (GRCm39) missense probably damaging 1.00
R5761:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R5849:Igf1r UTSW 7 67,839,781 (GRCm39) missense probably benign
R6189:Igf1r UTSW 7 67,857,084 (GRCm39) nonsense probably null
R6262:Igf1r UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
R6285:Igf1r UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
R6318:Igf1r UTSW 7 67,814,981 (GRCm39) missense probably benign 0.02
R6365:Igf1r UTSW 7 67,839,798 (GRCm39) missense probably benign 0.26
R6377:Igf1r UTSW 7 67,850,998 (GRCm39) missense probably benign 0.00
R6831:Igf1r UTSW 7 67,857,067 (GRCm39) missense possibly damaging 0.75
R6848:Igf1r UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
R6902:Igf1r UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
R7193:Igf1r UTSW 7 67,836,905 (GRCm39) missense probably damaging 1.00
R7373:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R7442:Igf1r UTSW 7 67,823,026 (GRCm39) missense probably damaging 1.00
R7903:Igf1r UTSW 7 67,834,500 (GRCm39) missense probably damaging 1.00
R7923:Igf1r UTSW 7 67,839,849 (GRCm39) missense probably damaging 1.00
R7932:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
R8368:Igf1r UTSW 7 67,836,796 (GRCm39) missense probably benign 0.03
R8458:Igf1r UTSW 7 67,845,377 (GRCm39) missense probably benign
R8539:Igf1r UTSW 7 67,653,596 (GRCm39) missense probably benign 0.06
R8704:Igf1r UTSW 7 67,819,802 (GRCm39) splice site probably benign
R8746:Igf1r UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
R8829:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8832:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8859:Igf1r UTSW 7 67,833,211 (GRCm39) missense possibly damaging 0.75
R9057:Igf1r UTSW 7 67,833,186 (GRCm39) missense probably damaging 1.00
R9243:Igf1r UTSW 7 67,861,775 (GRCm39) missense probably benign 0.11
R9342:Igf1r UTSW 7 67,844,746 (GRCm39) missense probably benign 0.00
R9412:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R9525:Igf1r UTSW 7 67,864,682 (GRCm39) missense probably damaging 1.00
R9727:Igf1r UTSW 7 67,857,554 (GRCm39) missense probably damaging 1.00
R9730:Igf1r UTSW 7 67,839,423 (GRCm39) missense probably damaging 1.00
R9779:Igf1r UTSW 7 67,654,065 (GRCm39) missense probably damaging 1.00
RF025:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF032:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF034:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF037:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF039:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF044:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,916 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,930 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,928 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,922 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,918 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,921 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGAACCACTGTTGTTTGG -3'
(R):5'- AGGCCTCGTTGAGAAACTCG -3'

Sequencing Primer
(F):5'- GGTTCTTAGCTACGAGTACCAC -3'
(R):5'- GAGAAACTCGATTCTTTCACGC -3'
Posted On 2014-08-01