Incidental Mutation 'R0132:Ntn4'
ID21698
Institutional Source Beutler Lab
Gene Symbol Ntn4
Ensembl Gene ENSMUSG00000020019
Gene Namenetrin 4
Synonymsbeta-netrin
MMRRC Submission 038417-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0132 (G1)
Quality Score221
Status Validated (trace)
Chromosome10
Chromosomal Location93640681-93747207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93644707 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 98 (S98T)
Ref Sequence ENSEMBL: ENSMUSP00000020204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020204] [ENSMUST00000147080]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020204
AA Change: S98T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: S98T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 28 260 6.48e-55 SMART
EGF_Lam 262 329 5.83e-7 SMART
EGF_Lam 332 392 3.32e-11 SMART
EGF_Lam 395 446 3.73e-14 SMART
C345C 516 625 5.58e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147080
AA Change: S61T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123306
Gene: ENSMUSG00000020019
AA Change: S61T

DomainStartEndE-ValueType
LamNT 1 143 4.24e-12 SMART
Meta Mutation Damage Score 0.1764 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.2%
  • 20x: 84.8%
Validation Efficiency 90% (52/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Ntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Ntn4 APN 10 93707349 missense probably damaging 1.00
IGL02212:Ntn4 APN 10 93644849 missense possibly damaging 0.50
IGL02698:Ntn4 APN 10 93644659 missense probably benign 0.19
IGL02752:Ntn4 APN 10 93710559 missense possibly damaging 0.84
PIT4468001:Ntn4 UTSW 10 93644725 missense probably damaging 0.99
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0131:Ntn4 UTSW 10 93644707 missense possibly damaging 0.89
R0419:Ntn4 UTSW 10 93682429 missense probably benign 0.04
R1304:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1306:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1307:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1308:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1619:Ntn4 UTSW 10 93644734 missense probably damaging 1.00
R1645:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1664:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1695:Ntn4 UTSW 10 93733602 splice site probably null
R1796:Ntn4 UTSW 10 93745771 missense probably damaging 1.00
R1806:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1845:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1856:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1872:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1879:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1901:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1902:Ntn4 UTSW 10 93707372 missense possibly damaging 0.93
R1925:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1926:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R1927:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2060:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2113:Ntn4 UTSW 10 93644839 missense probably damaging 1.00
R2202:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2203:Ntn4 UTSW 10 93707353 missense probably damaging 0.99
R2975:Ntn4 UTSW 10 93644891 missense probably damaging 1.00
R4277:Ntn4 UTSW 10 93741210 missense possibly damaging 0.95
R4805:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4806:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R4807:Ntn4 UTSW 10 93644500 missense probably damaging 0.99
R5818:Ntn4 UTSW 10 93644764 missense probably benign 0.40
R6048:Ntn4 UTSW 10 93707266 splice site probably null
R6051:Ntn4 UTSW 10 93745795 missense probably benign
R6346:Ntn4 UTSW 10 93644861 missense probably damaging 1.00
R6752:Ntn4 UTSW 10 93734175 missense probably benign
R7196:Ntn4 UTSW 10 93733714 missense probably benign 0.01
R7240:Ntn4 UTSW 10 93745741 missense probably damaging 0.99
R7365:Ntn4 UTSW 10 93644804 missense probably damaging 1.00
R7374:Ntn4 UTSW 10 93682572 missense probably benign
R7505:Ntn4 UTSW 10 93707284 missense probably damaging 1.00
R7509:Ntn4 UTSW 10 93710568 missense probably benign 0.01
R7726:Ntn4 UTSW 10 93733682 missense possibly damaging 0.82
RF045:Ntn4 UTSW 10 93710625 missense possibly damaging 0.95
X0024:Ntn4 UTSW 10 93644971 missense probably damaging 1.00
Z1176:Ntn4 UTSW 10 93741153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAACCCTCGCATGGGAAAC -3'
(R):5'- ACGTGCAAATAGCTCCCTTCTTGAC -3'

Sequencing Primer
(F):5'- TCGCATGGGAAACTTGGC -3'
(R):5'- CCGAGCAGTTTGTTGCAAAG -3'
Posted On2013-04-11