Mutagenetix > Incidental Mutations

Incidental Mutation 'R0132:Nap1l1'

21701

Institutional Source

Beutler Lab

Gene Symbol

Nap1l1

Ensembl Gene

ENSMUSG00000058799

Gene Name

nucleosome assembly protein 1-like 1

Synonyms

D10Ertd68e

MMRRC Submission

038417-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.289) question?

Stock #

R0132 (G1)

Quality Score

212

Status

Validated (trace)

Chromosome

Chromosomal Location

111473223-111498150 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111485509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 37 (S37P)

Ref Sequence

ENSEMBL: ENSMUSP00000126850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]

AlphaFold

P28656

Predicted Effect

probably benign
Transcript: ENSMUST00000065917
AA Change: S10P

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799
AA Change: S10P

Domain	Start	End	E-Value	Type
coiled coil region	6	31	N/A	INTRINSIC
Pfam:NAP	75	346	1.5e-96	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157194

Predicted Effect

probably benign
Transcript: ENSMUST00000171797
AA Change: S37P

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799
AA Change: S37P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
coiled coil region	33	58	N/A	INTRINSIC
Pfam:NAP	103	372	9.6e-110	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217908
AA Change: S10P

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000218828
AA Change: S10P

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000219143
AA Change: S10P

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000219961
AA Change: S10P

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0605

Coding Region Coverage

1x: 99.1%
3x: 97.9%
10x: 94.2%
20x: 84.8%

Validation Efficiency

90% (52/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	A	G	7: 28,137,615	R320G	probably damaging	Het
Abcc12	A	G	8: 86,531,568	I773T	probably benign	Het
Adamtsl1	T	A	4: 86,342,723	I1057N	possibly damaging	Het
Anxa5	G	A	3: 36,450,672	A247V	probably damaging	Het
Ascc3	T	G	10: 50,735,329	W1589G	probably damaging	Het
Atp2b2	G	A	6: 113,793,782	P389S	probably damaging	Het
Bpifa6	T	A	2: 153,982,931	S9T	probably benign	Het
Chd8	A	G	14: 52,205,326	V589A	probably benign	Het
Chrnb2	T	C	3: 89,764,406	M1V	probably null	Het
Col16a1	T	A	4: 130,067,096	V449E	unknown	Het
Cttnbp2nl	T	G	3: 105,005,857	K237T	probably damaging	Het
Dazap1	T	G	10: 80,278,226		probably null	Het
Fam187b	T	A	7: 30,989,120	V22E	probably damaging	Het
Gm4788	T	A	1: 139,754,271	T196S	probably damaging	Het
H2-T24	T	A	17: 36,014,986	I238F	probably damaging	Het
Hectd4	A	G	5: 121,333,024	E2658G	probably benign	Het
Herc1	A	C	9: 66,480,910	I3826L	probably benign	Het
Hinfp	A	G	9: 44,299,763	C67R	probably damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Hspg2	T	C	4: 137,551,887	Y3094H	probably damaging	Het
Htr1f	A	G	16: 64,926,728	V67A	probably damaging	Het
Iqcc	T	G	4: 129,616,599	E374D	probably damaging	Het
Kcnj9	T	C	1: 172,326,198	T120A	probably damaging	Het
Kitl	C	T	10: 100,087,364	P208S	probably benign	Het
Lpcat4	A	G	2: 112,246,748	Y479C	probably damaging	Het
Lrrc74b	T	C	16: 17,553,152	N227S	probably damaging	Het
Mdc1	T	A	17: 35,852,581	V1007D	probably damaging	Het
Mocos	T	G	18: 24,679,762	I571S	probably benign	Het
Myh8	A	G	11: 67,292,188	N659D	probably damaging	Het
Naip2	A	G	13: 100,183,788	V240A	probably benign	Het
Nin	T	G	12: 70,051,141	K515T	probably damaging	Het
Npl	T	A	1: 153,509,118	K258*	probably null	Het
Ntn4	T	A	10: 93,644,707	S98T	possibly damaging	Het
Olfr177	C	A	16: 58,872,906	M81I	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr417	T	C	1: 174,369,586	V223A	probably damaging	Het
Ppox	C	A	1: 171,279,275	A192S	possibly damaging	Het
Prkdc	T	C	16: 15,713,653	L1380S	probably benign	Het
Psd4	C	A	2: 24,405,351	A839E	probably damaging	Het
Ptprn2	T	G	12: 116,722,091	F57V	probably damaging	Het
Ptprt	C	T	2: 162,278,110	V146I	probably benign	Het
R3hdm2	T	A	10: 127,498,453	M915K	probably damaging	Het
Rab26	C	T	17: 24,530,785		probably null	Het
Rnf213	A	G	11: 119,430,361	E1215G	probably benign	Het
Rprd2	T	C	3: 95,774,361	K407E	probably damaging	Het
Siah3	G	A	14: 75,456,134	V27I	possibly damaging	Het
Slc14a2	T	A	18: 78,192,123	N280Y	probably damaging	Het
Slc25a35	A	G	11: 68,971,960	Y247C	probably damaging	Het
Slc29a4	A	G	5: 142,705,530	D55G	probably benign	Het
Slc35d1	C	T	4: 103,208,181	V189I	probably benign	Het
Srrm1	G	A	4: 135,340,573	R322*	probably null	Het
Stac3	A	T	10: 127,503,650	R138S	probably damaging	Het
Tmem260	T	A	14: 48,483,322	C306*	probably null	Het
Tspyl1	A	G	10: 34,283,089	N270S	probably damaging	Het
Ugt2a2	T	A	5: 87,474,861	K293*	probably null	Het
Vmn2r102	A	C	17: 19,678,763	T456P	probably benign	Het
Vmn2r90	T	A	17: 17,712,249	S139R	probably benign	Het
Zmym2	A	G	14: 56,943,258	N876D	probably benign	Het

Other mutations in Nap1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Nap1l1	APN	10	111486675	missense	probably damaging	0.98
IGL01453:Nap1l1	APN	10	111492978	missense	probably benign	0.09
IGL01734:Nap1l1	APN	10	111492899	missense	probably benign	0.26
IGL01843:Nap1l1	APN	10	111492911	missense	possibly damaging	0.93
PIT1430001:Nap1l1	UTSW	10	111486736	missense	probably damaging	1.00
PIT4131001:Nap1l1	UTSW	10	111486722	missense	probably null
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0601:Nap1l1	UTSW	10	111490363	splice site	probably benign
R1576:Nap1l1	UTSW	10	111494820	missense	probably damaging	1.00
R1619:Nap1l1	UTSW	10	111493379	missense	possibly damaging	0.77
R1969:Nap1l1	UTSW	10	111491053	missense	probably benign	0.03
R2071:Nap1l1	UTSW	10	111492900	missense	possibly damaging	0.46
R2383:Nap1l1	UTSW	10	111493411	missense	probably damaging	1.00
R3836:Nap1l1	UTSW	10	111495322	splice site	probably null
R3837:Nap1l1	UTSW	10	111495322	splice site	probably null
R3838:Nap1l1	UTSW	10	111495322	splice site	probably null
R3839:Nap1l1	UTSW	10	111495322	splice site	probably null
R4084:Nap1l1	UTSW	10	111490077	missense	possibly damaging	0.92
R4609:Nap1l1	UTSW	10	111492880	nonsense	probably null
R4985:Nap1l1	UTSW	10	111490083	missense	probably benign	0.01
R5906:Nap1l1	UTSW	10	111491030	nonsense	probably null
R5982:Nap1l1	UTSW	10	111495368	missense	possibly damaging	0.71
R6522:Nap1l1	UTSW	10	111494223	missense	probably damaging	0.99
R6868:Nap1l1	UTSW	10	111494808	missense	probably damaging	1.00
R7134:Nap1l1	UTSW	10	111494794	critical splice acceptor site	probably null
R7202:Nap1l1	UTSW	10	111491103	missense	probably damaging	1.00
R7789:Nap1l1	UTSW	10	111490456	missense	probably benign	0.01
R7950:Nap1l1	UTSW	10	111492908	missense	probably damaging	1.00
R8404:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8502:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8933:Nap1l1	UTSW	10	111492849	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACCAAATGCAGCTTGATGTTTCCAC -3'
(R):5'- AGTTCCTGACACAGCAGCAGTG -3'

Sequencing Primer
(F):5'- CTTGATGTTTCCACTGTGGTTG -3'
(R):5'- CAGTTCCTGAACTCAAGGACTGG -3'

Posted On

2013-04-11