Incidental Mutation 'R1962:Eml5'
ID 217021
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 039976-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R1962 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 98753064-98867743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98842570 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 176 (F176S)
Ref Sequence ENSEMBL: ENSMUSP00000065643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably damaging
Transcript: ENSMUST00000065716
AA Change: F176S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: F176S

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: F176S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 119,940,468 (GRCm39) I354M probably damaging Het
Abca8a T C 11: 109,917,731 (GRCm39) probably null Het
Abca8b T C 11: 109,870,724 (GRCm39) R143G probably benign Het
Actn4 T C 7: 28,594,047 (GRCm39) D840G probably damaging Het
Agpat5 T C 8: 18,928,026 (GRCm39) L197P probably damaging Het
Akr1d1 T C 6: 37,512,983 (GRCm39) V93A probably benign Het
Arap2 T C 5: 62,834,007 (GRCm39) K820R possibly damaging Het
Armc9 T A 1: 86,135,696 (GRCm39) C551S probably damaging Het
Atg7 T C 6: 114,683,191 (GRCm39) L418P probably damaging Het
Awat2 G A X: 99,448,165 (GRCm39) P148S probably damaging Het
Brms1 C T 19: 5,096,027 (GRCm39) R34W probably damaging Het
Cbx2 A G 11: 118,919,395 (GRCm39) Q320R possibly damaging Het
Ccdc106 G A 7: 5,062,539 (GRCm39) D11N possibly damaging Het
Ccdc30 C T 4: 119,196,988 (GRCm39) R426Q probably benign Het
Cdc42bpg T A 19: 6,356,885 (GRCm39) V47E probably damaging Het
Cep170b C T 12: 112,704,495 (GRCm39) S751L probably damaging Het
Cfap46 A T 7: 139,246,957 (GRCm39) L328Q probably damaging Het
Crtc3 A G 7: 80,239,679 (GRCm39) F558L probably damaging Het
Cyp2d34 A G 15: 82,502,809 (GRCm39) V139A probably benign Het
Dchs1 A G 7: 105,413,408 (GRCm39) Y1136H probably damaging Het
Dhrs4 T C 14: 55,725,060 (GRCm39) V185A probably damaging Het
Dnah7b A G 1: 46,281,263 (GRCm39) K2775E possibly damaging Het
Dst C A 1: 34,230,097 (GRCm39) S2238R possibly damaging Het
Duox2 T C 2: 122,127,853 (GRCm39) probably null Het
Dusp16 G T 6: 134,695,099 (GRCm39) Y577* probably null Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Esco2 C A 14: 66,068,982 (GRCm39) R109S probably damaging Het
Galnt7 C T 8: 57,985,748 (GRCm39) E541K probably benign Het
Gbf1 C T 19: 46,255,658 (GRCm39) T707I probably damaging Het
Gdf5 A G 2: 155,783,672 (GRCm39) C427R probably damaging Het
Glyctk T C 9: 106,035,064 (GRCm39) M1V probably null Het
Gm5478 T C 15: 101,552,830 (GRCm39) E367G probably damaging Het
Golga7b G A 19: 42,251,768 (GRCm39) V5I probably benign Het
Gpt2 T C 8: 86,219,764 (GRCm39) L70P probably damaging Het
Gsdmc3 C A 15: 63,730,315 (GRCm39) Q416H probably damaging Het
Hoxb5 A G 11: 96,194,918 (GRCm39) E160G probably benign Het
Ift81 A T 5: 122,698,772 (GRCm39) Y532N probably benign Het
Igf1 G A 10: 87,700,726 (GRCm39) C66Y probably damaging Het
Igf1r T C 7: 67,857,023 (GRCm39) V995A probably damaging Het
Ip6k1 T C 9: 107,918,287 (GRCm39) probably null Het
Jaml T C 9: 45,015,495 (GRCm39) I333T possibly damaging Het
Kdm4c T C 4: 74,225,253 (GRCm39) probably benign Het
Kdm6b T C 11: 69,292,191 (GRCm39) probably benign Het
Krt6a C T 15: 101,599,900 (GRCm39) R404H probably damaging Het
Larp4b C A 13: 9,186,878 (GRCm39) H69N probably benign Het
Lcat A T 8: 106,668,355 (GRCm39) W222R probably damaging Het
Lrrc40 T A 3: 157,746,086 (GRCm39) C54S probably benign Het
Mcpt9 T A 14: 56,265,024 (GRCm39) H159L probably benign Het
Megf8 T C 7: 25,062,976 (GRCm39) V2444A probably damaging Het
Memo1 T C 17: 74,552,003 (GRCm39) T98A possibly damaging Het
Mical2 A T 7: 112,012,051 (GRCm39) I634L probably benign Het
Mov10 C T 3: 104,704,293 (GRCm39) R835Q probably damaging Het
Mybpc1 A T 10: 88,384,688 (GRCm39) L546Q probably damaging Het
Myo6 T C 9: 80,168,117 (GRCm39) V427A probably damaging Het
Myom2 T A 8: 15,182,599 (GRCm39) probably null Het
Mzt2 G A 16: 15,666,543 (GRCm39) R125C probably damaging Het
Neb T A 2: 52,162,949 (GRCm39) R2031* probably null Het
Nphp3 T C 9: 103,898,537 (GRCm39) S447P probably benign Het
Nrp2 T A 1: 62,758,090 (GRCm39) D25E probably benign Het
Nts A G 10: 102,320,918 (GRCm39) L57S probably damaging Het
Nudt9 G A 5: 104,212,971 (GRCm39) R348H probably benign Het
Or10d5j T C 9: 39,867,979 (GRCm39) Y84C probably benign Het
Or13a1 C T 6: 116,470,725 (GRCm39) P52S probably benign Het
Or3a1b C A 11: 74,012,650 (GRCm39) D178E probably benign Het
Or4k49 T C 2: 111,495,234 (GRCm39) I221T probably damaging Het
Or5ac16 T A 16: 59,022,271 (GRCm39) I173F possibly damaging Het
Pafah1b1 T C 11: 74,590,177 (GRCm39) probably benign Het
Piezo2 C A 18: 63,211,911 (GRCm39) M1291I probably damaging Het
Pik3ca T C 3: 32,498,016 (GRCm39) F486S probably benign Het
Podnl1 C T 8: 84,853,926 (GRCm39) H99Y probably benign Het
Prdm6 A T 18: 53,701,233 (GRCm39) Y341F probably damaging Het
Prr5l C T 2: 101,588,854 (GRCm39) probably null Het
Psmd4 G T 3: 94,944,012 (GRCm39) T24N possibly damaging Het
Rbbp8nl G A 2: 179,922,667 (GRCm39) T242M probably benign Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,229,113 (GRCm39) probably benign Het
Scfd1 T C 12: 51,469,769 (GRCm39) V438A probably benign Het
Scn9a A G 2: 66,314,655 (GRCm39) C1677R probably damaging Het
Sgsm2 T A 11: 74,782,854 (GRCm39) H34L probably damaging Het
Shank1 T A 7: 43,993,747 (GRCm39) probably null Het
Smarca2 G T 19: 26,650,124 (GRCm39) E24* probably null Het
Sncaip C T 18: 53,004,434 (GRCm39) H354Y probably damaging Het
St8sia2 T A 7: 73,593,057 (GRCm39) D333V probably damaging Het
Stxbp2 C A 8: 3,692,672 (GRCm39) R575S probably benign Het
Syt9 T A 7: 107,024,314 (GRCm39) V69D probably damaging Het
Tanc2 A G 11: 105,689,558 (GRCm39) N240S probably benign Het
Tcl1b1 T C 12: 105,130,727 (GRCm39) L70S probably benign Het
Tmem44 C T 16: 30,362,219 (GRCm39) probably null Het
Tor1b A G 2: 30,846,931 (GRCm39) R293G probably benign Het
Trim29 T C 9: 43,222,615 (GRCm39) V148A probably benign Het
Trmt10b C A 4: 45,314,378 (GRCm39) Y271* probably null Het
Ubqln5 A T 7: 103,778,095 (GRCm39) V243E possibly damaging Het
Ubqln5 T C 7: 103,778,134 (GRCm39) D230G probably damaging Het
Ugt2b37 A G 5: 87,402,193 (GRCm39) F146S probably damaging Het
Vmn1r160 T A 7: 22,570,827 (GRCm39) V60E probably damaging Het
Vmn2r109 T A 17: 20,774,185 (GRCm39) D390V probably damaging Het
Vmn2r27 C T 6: 124,200,793 (GRCm39) R388Q possibly damaging Het
Vmn2r72 A T 7: 85,398,369 (GRCm39) V537D probably benign Het
Vmn2r84 A G 10: 130,226,591 (GRCm39) S416P probably damaging Het
Vmn2r98 C A 17: 19,285,595 (GRCm39) Y138* probably null Het
Vmn2r-ps158 T C 7: 42,696,824 (GRCm39) V620A probably benign Het
Xrra1 A C 7: 99,560,227 (GRCm39) E401A probably damaging Het
Zfp280d T A 9: 72,242,362 (GRCm39) C688* probably null Het
Zfp3 T A 11: 70,662,954 (GRCm39) Y304* probably null Het
Zfp407 A T 18: 84,577,461 (GRCm39) D1217E probably benign Het
Zfp658 T C 7: 43,223,245 (GRCm39) Y507H possibly damaging Het
Zfyve16 T C 13: 92,659,252 (GRCm39) T220A possibly damaging Het
Zmym4 C G 4: 126,796,463 (GRCm39) K820N possibly damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98,839,468 (GRCm39) splice site probably benign
IGL00473:Eml5 APN 12 98,771,751 (GRCm39) splice site probably benign
IGL01120:Eml5 APN 12 98,810,278 (GRCm39) missense probably benign
IGL01308:Eml5 APN 12 98,768,572 (GRCm39) missense probably damaging 1.00
IGL01790:Eml5 APN 12 98,765,191 (GRCm39) missense probably damaging 1.00
IGL01973:Eml5 APN 12 98,829,539 (GRCm39) missense probably benign
IGL02182:Eml5 APN 12 98,768,581 (GRCm39) missense probably damaging 1.00
IGL02201:Eml5 APN 12 98,760,683 (GRCm39) splice site probably benign
IGL02375:Eml5 APN 12 98,810,346 (GRCm39) missense probably damaging 1.00
IGL02397:Eml5 APN 12 98,756,933 (GRCm39) missense probably benign 0.07
IGL02480:Eml5 APN 12 98,842,502 (GRCm39) missense probably damaging 1.00
IGL02801:Eml5 APN 12 98,784,104 (GRCm39) missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98,825,100 (GRCm39) missense probably damaging 1.00
IGL03104:Eml5 APN 12 98,827,504 (GRCm39) nonsense probably null
IGL03158:Eml5 APN 12 98,793,773 (GRCm39) splice site probably benign
IGL03286:Eml5 APN 12 98,826,762 (GRCm39) missense probably damaging 1.00
IGL03380:Eml5 APN 12 98,840,906 (GRCm39) splice site probably benign
BB010:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98,791,031 (GRCm39) splice site probably null
R0624:Eml5 UTSW 12 98,831,738 (GRCm39) missense probably damaging 1.00
R0993:Eml5 UTSW 12 98,827,442 (GRCm39) missense probably benign 0.25
R1073:Eml5 UTSW 12 98,797,232 (GRCm39) missense probably damaging 1.00
R1183:Eml5 UTSW 12 98,758,305 (GRCm39) missense probably benign 0.31
R1352:Eml5 UTSW 12 98,797,262 (GRCm39) splice site probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1503:Eml5 UTSW 12 98,797,433 (GRCm39) missense probably damaging 0.99
R1538:Eml5 UTSW 12 98,760,535 (GRCm39) missense probably damaging 0.99
R1689:Eml5 UTSW 12 98,797,194 (GRCm39) missense probably damaging 1.00
R1773:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1775:Eml5 UTSW 12 98,818,963 (GRCm39) splice site probably null
R1791:Eml5 UTSW 12 98,853,315 (GRCm39) missense probably benign 0.31
R1856:Eml5 UTSW 12 98,776,843 (GRCm39) missense probably damaging 1.00
R1919:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1957:Eml5 UTSW 12 98,826,220 (GRCm39) missense probably damaging 1.00
R2033:Eml5 UTSW 12 98,757,645 (GRCm39) missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98,760,525 (GRCm39) missense probably benign 0.33
R2073:Eml5 UTSW 12 98,768,705 (GRCm39) missense probably damaging 0.99
R2143:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2144:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2158:Eml5 UTSW 12 98,810,205 (GRCm39) splice site probably benign
R2164:Eml5 UTSW 12 98,853,356 (GRCm39) missense probably damaging 0.99
R2175:Eml5 UTSW 12 98,842,482 (GRCm39) nonsense probably null
R2200:Eml5 UTSW 12 98,791,676 (GRCm39) missense probably damaging 1.00
R2234:Eml5 UTSW 12 98,807,840 (GRCm39) missense probably damaging 1.00
R2504:Eml5 UTSW 12 98,810,364 (GRCm39) missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2958:Eml5 UTSW 12 98,842,437 (GRCm39) missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98,847,067 (GRCm39) splice site probably null
R3118:Eml5 UTSW 12 98,831,753 (GRCm39) missense probably damaging 0.97
R3735:Eml5 UTSW 12 98,822,248 (GRCm39) missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98,782,283 (GRCm39) missense probably damaging 1.00
R3900:Eml5 UTSW 12 98,791,782 (GRCm39) missense probably damaging 1.00
R3973:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R3976:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R4105:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4107:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4108:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4109:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4258:Eml5 UTSW 12 98,831,693 (GRCm39) missense probably benign 0.01
R4381:Eml5 UTSW 12 98,782,214 (GRCm39) missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98,803,600 (GRCm39) missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98,765,111 (GRCm39) missense probably damaging 1.00
R4775:Eml5 UTSW 12 98,768,566 (GRCm39) missense probably benign 0.05
R4850:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5007:Eml5 UTSW 12 98,797,224 (GRCm39) missense probably damaging 1.00
R5092:Eml5 UTSW 12 98,758,875 (GRCm39) missense probably damaging 1.00
R5123:Eml5 UTSW 12 98,840,771 (GRCm39) missense probably damaging 1.00
R5124:Eml5 UTSW 12 98,758,301 (GRCm39) missense probably damaging 1.00
R5273:Eml5 UTSW 12 98,756,947 (GRCm39) missense probably damaging 1.00
R5369:Eml5 UTSW 12 98,825,042 (GRCm39) missense probably damaging 1.00
R5430:Eml5 UTSW 12 98,760,417 (GRCm39) missense probably damaging 1.00
R5748:Eml5 UTSW 12 98,791,814 (GRCm39) missense probably damaging 0.99
R5769:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5832:Eml5 UTSW 12 98,842,447 (GRCm39) missense probably benign
R6113:Eml5 UTSW 12 98,790,933 (GRCm39) nonsense probably null
R6131:Eml5 UTSW 12 98,827,510 (GRCm39) missense probably damaging 0.99
R6175:Eml5 UTSW 12 98,760,715 (GRCm39) missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98,829,388 (GRCm39) missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98,837,143 (GRCm39) missense probably damaging 0.98
R6375:Eml5 UTSW 12 98,765,127 (GRCm39)
R6528:Eml5 UTSW 12 98,790,896 (GRCm39) missense probably benign 0.18
R6657:Eml5 UTSW 12 98,757,664 (GRCm39) missense probably damaging 0.98
R6717:Eml5 UTSW 12 98,793,765 (GRCm39) missense probably damaging 1.00
R6751:Eml5 UTSW 12 98,831,659 (GRCm39) missense probably damaging 1.00
R6833:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6834:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6972:Eml5 UTSW 12 98,842,439 (GRCm39) missense probably benign 0.00
R7091:Eml5 UTSW 12 98,768,733 (GRCm39) missense probably benign 0.16
R7353:Eml5 UTSW 12 98,791,683 (GRCm39) missense
R7644:Eml5 UTSW 12 98,822,203 (GRCm39) missense probably benign 0.05
R7694:Eml5 UTSW 12 98,758,822 (GRCm39) missense probably damaging 0.99
R7842:Eml5 UTSW 12 98,760,394 (GRCm39) missense probably damaging 1.00
R7933:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98,758,773 (GRCm39) critical splice donor site probably null
R8198:Eml5 UTSW 12 98,825,145 (GRCm39) nonsense probably null
R8482:Eml5 UTSW 12 98,842,560 (GRCm39) missense probably damaging 1.00
R8732:Eml5 UTSW 12 98,782,218 (GRCm39) missense probably damaging 0.99
R8956:Eml5 UTSW 12 98,818,952 (GRCm39) missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98,776,829 (GRCm39) missense probably damaging 0.99
R9131:Eml5 UTSW 12 98,825,099 (GRCm39) missense probably damaging 1.00
R9258:Eml5 UTSW 12 98,810,376 (GRCm39) missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98,822,287 (GRCm39) missense probably damaging 0.99
R9276:Eml5 UTSW 12 98,765,060 (GRCm39) missense probably damaging 0.99
R9301:Eml5 UTSW 12 98,848,292 (GRCm39) nonsense probably null
R9368:Eml5 UTSW 12 98,762,837 (GRCm39) missense probably benign 0.31
R9392:Eml5 UTSW 12 98,867,199 (GRCm39) missense probably damaging 1.00
R9393:Eml5 UTSW 12 98,842,433 (GRCm39) missense probably benign 0.35
R9449:Eml5 UTSW 12 98,827,554 (GRCm39) missense probably damaging 1.00
R9570:Eml5 UTSW 12 98,782,243 (GRCm39) missense probably benign 0.15
T0722:Eml5 UTSW 12 98,807,841 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTTACAGTATGGGCTCCTTGTATTG -3'
(R):5'- ACCGATAAGGATTGAAACTAGTGAC -3'

Sequencing Primer
(F):5'- TGTTCGTATAAGATTGATTCCTTTCC -3'
(R):5'- GGATTGAAACTAGTGACTAATCTGC -3'
Posted On 2014-08-01